EMAIL THIS PAGE TO A FRIEND

PPP1R12C

protein phosphatase 1, regulatory subunit 12C

139 Gene Product Result for
Synonyms: LENG3 MBS85 p84 p85
Gene ID:
Human(54776) Summary: The gene encodes a subunit of myosin phosphatase. The encoded protein regulates the catalytic activity of protein phosphatase 1 delta and assembly of the actin cytoskeleton. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
Mouse(232807) protein phosphatase 1, regulatory (inhibitor) subunit 12C
Rat(499076) protein phosphatase 1, regulatory subunit 12C
Zebrafish(570218) protein phosphatase 1, regulatory subunit 12C
Horse(100050275) protein phosphatase 1, regulatory subunit 12C
domestic cat(101092809) protein phosphatase 1, regulatory subunit 12C
dog(100683226) protein phosphatase 1, regulatory subunit 12C
domestic guinea pig(100714649) protein phosphatase 1, regulatory subunit 12C
naked mole-rat(101714373) protein phosphatase 1, regulatory subunit 12C
cow(512431) protein phosphatase 1, regulatory subunit 12C
sheep(101122546) protein phosphatase 1, regulatory subunit 12C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017607 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017607 Rosetta Predictions human pricing
XM_001071078 Rosetta Predictions rat pricing
XM_574359 Rosetta Predictions rat pricing
NM_029834 Rosetta Predictions mouse pricing
XM_976362 Rosetta Predictions mouse pricing
XM_976397 Rosetta Predictions mouse pricing
XM_976435 Rosetta Predictions mouse pricing
XM_976476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200313 predicted 2176
2 SASI_Hs01_00200314 predicted 1696
3 SASI_Hs01_00200315 predicted 1511
4 SASI_Hs01_00200316 predicted 2638
5 SASI_Hs01_00200317 predicted 934
6 SASI_Hs01_00200318 predicted 2637
7 SASI_Hs01_00200319 predicted 2371
8 SASI_Hs01_00200320 predicted 2350
9 SASI_Hs01_00200321 predicted 2050
10 SASI_Hs02_00350277 predicted 2293
11 SASI_Hs01_00200322 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333795 predicted 982
2 SASI_Rn02_00333796 predicted 1612
3 SASI_Rn02_00333797 predicted 942
4 SASI_Rn02_00333798 predicted 2138
5 SASI_Rn02_00333799 predicted 417
6 SASI_Rn02_00333800 predicted 2010
7 SASI_Rn02_00333801 predicted 558
8 SASI_Rn02_00333802 predicted 2248
9 SASI_Rn02_00333803 predicted 2286
10 SASI_Rn02_00333804 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401851 predicted 1067
2 SASI_Rn02_00401852 predicted 1704
3 SASI_Rn02_00401853 predicted 1036
4 SASI_Rn02_00401854 predicted 2232
5 SASI_Rn02_00401855 predicted 507
6 SASI_Rn02_00401856 predicted 2101
7 SASI_Rn02_00401857 predicted 653
8 SASI_Rn02_00401858 predicted 2344
9 SASI_Rn02_00401859 predicted 2374
10 SASI_Rn02_00401860 predicted 1548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336014 predicted 1198
2 SASI_Mm02_00336015 predicted 1766
3 SASI_Mm02_00336016 predicted 2395
4 SASI_Mm02_00336017 predicted 1090
5 SASI_Mm02_00336018 predicted 1756
6 SASI_Mm02_00336019 predicted 2358
7 SASI_Mm02_00336020 predicted 700
8 SASI_Mm02_00336021 predicted 2519
9 SASI_Mm02_00336022 predicted 1143
10 SASI_Mm02_00336023 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266504 predicted 1360
2 SASI_Mm01_00266505 predicted 1413
3 SASI_Mm01_00266506 predicted 1367
4 SASI_Mm01_00266507 predicted 1454
5 SASI_Mm01_00266508 predicted 1412
6 SASI_Mm01_00266509 predicted 1453
7 SASI_Mm01_00266510 predicted 609
8 SASI_Mm01_00266511 predicted 1064
9 SASI_Mm01_00266512 predicted 1355
10 SASI_Mm01_00266513 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259840 predicted 709
2 SASI_Mm01_00259841 predicted 1278
3 SASI_Mm01_00259842 predicted 1905
4 SASI_Mm01_00259843 predicted 602
5 SASI_Mm01_00259844 predicted 1271
6 SASI_Mm01_00259845 predicted 638
7 SASI_Mm01_00259846 predicted 637
8 SASI_Mm01_00259847 predicted 1872
9 SASI_Mm01_00259848 predicted 205
10 SASI_Mm01_00259849 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273647 predicted 647
2 SASI_Mm01_00273648 predicted 1320
3 SASI_Mm01_00273649 predicted 964
4 SASI_Mm01_00273650 predicted 1001
5 SASI_Mm01_00273651 predicted 1642
6 SASI_Mm01_00273652 predicted 1323
7 SASI_Mm01_00273653 predicted 957
8 SASI_Mm01_00273654 predicted 725
9 SASI_Mm01_00273655 predicted 1267
10 SASI_Mm01_00273656 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270487 predicted 1586
2 SASI_Mm01_00270488 predicted 2147
3 SASI_Mm01_00270489 predicted 2773
4 SASI_Mm01_00270490 predicted 1478
5 SASI_Mm01_00270491 predicted 1510
6 SASI_Mm01_00270492 predicted 2747
7 SASI_Mm01_00270493 predicted 1084
8 SASI_Mm01_00270494 predicted 2903
9 SASI_Mm01_00270495 predicted 1530
10 SASI_Mm01_00270496 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017607
VALIDATED
PPP1R12C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 12C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017607.2-1059s21c1
Sequence:CCGGTGAGCAGTCGCGAGAAGATTTCTCGAGAAATCTTCTCGCGACTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017607.2-442s21c1
Sequence:CCGGCTCCTGTGGCTACCTAGATATCTCGAGATATCTAGGTAGCCACAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017607.2-1411s21c1
Sequence:CCGGGCTCCGTCTTGCCAGAATTACCTCGAGGTAATTCTGGCAAGACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017607.2-2375s21c1
Sequence:CCGGACTTTCCCGCACCCGTATTTACTCGAGTAAATACGGGTGCGGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017607.2-2058s21c1
Sequence:CCGGGAGGCTTTAGGACGCTGTATGCTCGAGCATACAGCGTCCTAAAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_017607.x-1628s1c1
Sequence:CCGGTGCGGGATGAGGAGTCGGAATCTCGAGATTCCGACTCCTCATCCCGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017607.x-2318s1c1
Sequence:CCGGAGGATGAGAATGCAGCGTTGACTCGAGTCAACGCTGCATTCTCATCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_017607.x-2636s1c1
Sequence:CCGGCAAGAAGTGCAAGGATCAGTACTCGAGTACTGATCCTTGCACTTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017607.x-608s1c1
Sequence:CCGGCCAAGCGGGCAGAAGAGGAATCTCGAGATTCCTCTTCTGCCCGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017607
VALIDATED
PPP1R12C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 12C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017607.2-1059s21c1
Sequence:CCGGTGAGCAGTCGCGAGAAGATTTCTCGAGAAATCTTCTCGCGACTGCTCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000237857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017607.2-442s21c1
Sequence:CCGGCTCCTGTGGCTACCTAGATATCTCGAGATATCTAGGTAGCCACAGGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000237854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017607.2-1411s21c1
Sequence:CCGGGCTCCGTCTTGCCAGAATTACCTCGAGGTAATTCTGGCAAGACGGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000237855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017607.2-2375s21c1
Sequence:CCGGACTTTCCCGCACCCGTATTTACTCGAGTAAATACGGGTGCGGGAAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000237856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017607.2-2058s21c1
Sequence:CCGGGAGGCTTTAGGACGCTGTATGCTCGAGCATACAGCGTCCTAAAGCCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_017607.x-1628s1c1
Sequence:CCGGTGCGGGATGAGGAGTCGGAATCTCGAGATTCCGACTCCTCATCCCGCATTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017607.x-2318s1c1
Sequence:CCGGAGGATGAGAATGCAGCGTTGACTCGAGTCAACGCTGCATTCTCATCCTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_017607.x-2636s1c1
Sequence:CCGGCAAGAAGTGCAAGGATCAGTACTCGAGTACTGATCCTTGCACTTCTTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017607.x-608s1c1
Sequence:CCGGCCAAGCGGGCAGAAGAGGAATCTCGAGATTCCTCTTCTGCCCGCTTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017607
VALIDATED
PPP1R12C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 12C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017607.2-1059s21c1
Sequence:CCGGTGAGCAGTCGCGAGAAGATTTCTCGAGAAATCTTCTCGCGACTGCTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000237857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017607.2-442s21c1
Sequence:CCGGCTCCTGTGGCTACCTAGATATCTCGAGATATCTAGGTAGCCACAGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000237854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017607.2-1411s21c1
Sequence:CCGGGCTCCGTCTTGCCAGAATTACCTCGAGGTAATTCTGGCAAGACGGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000237855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017607.2-2375s21c1
Sequence:CCGGACTTTCCCGCACCCGTATTTACTCGAGTAAATACGGGTGCGGGAAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000237856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017607.2-2058s21c1
Sequence:CCGGGAGGCTTTAGGACGCTGTATGCTCGAGCATACAGCGTCCTAAAGCCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_017607.x-1628s1c1
Sequence:CCGGTGCGGGATGAGGAGTCGGAATCTCGAGATTCCGACTCCTCATCCCGCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017607.x-2318s1c1
Sequence:CCGGAGGATGAGAATGCAGCGTTGACTCGAGTCAACGCTGCATTCTCATCCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_017607.x-2636s1c1
Sequence:CCGGCAAGAAGTGCAAGGATCAGTACTCGAGTACTGATCCTTGCACTTCTTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017607.x-608s1c1
Sequence:CCGGCCAAGCGGGCAGAAGAGGAATCTCGAGATTCCTCTTCTGCCCGCTTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029834
VALIDATED
PPP1R12C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 12C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029834.1-678s1c1
Sequence:CCGGGCTGAAGAAGAATTGCTGCTTCTCGAGAAGCAGCAATTCTTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029834.1-816s1c1
Sequence:CCGGGCTAGGCCAGAGTGATTGTTTCTCGAGAAACAATCACTCTGGCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029834.1-681s1c1
Sequence:CCGGGAAGAAGAATTGCTGCTTCATCTCGAGATGAAGCAGCAATTCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029834.1-596s1c1
Sequence:CCGGCCTGGCTGAGTCAGATGCCATCTCGAGATGGCATCTGACTCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029834.1-411s1c1
Sequence:CCGGGATGAGAACCTGGAAGTCGTTCTCGAGAACGACTTCCAGGTTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029834
VALIDATED
PPP1R12C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 12C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029834.1-678s1c1
Sequence:CCGGGCTGAAGAAGAATTGCTGCTTCTCGAGAAGCAGCAATTCTTCTTCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000084213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029834.1-816s1c1
Sequence:CCGGGCTAGGCCAGAGTGATTGTTTCTCGAGAAACAATCACTCTGGCCTAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000084215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029834.1-681s1c1
Sequence:CCGGGAAGAAGAATTGCTGCTTCATCTCGAGATGAAGCAGCAATTCTTCTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000084217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029834.1-596s1c1
Sequence:CCGGCCTGGCTGAGTCAGATGCCATCTCGAGATGGCATCTGACTCAGCCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000084216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029834.1-411s1c1
Sequence:CCGGGATGAGAACCTGGAAGTCGTTCTCGAGAACGACTTCCAGGTTCTCATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029834
VALIDATED
PPP1R12C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 12C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029834.1-678s1c1
Sequence:CCGGGCTGAAGAAGAATTGCTGCTTCTCGAGAAGCAGCAATTCTTCTTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029834.1-816s1c1
Sequence:CCGGGCTAGGCCAGAGTGATTGTTTCTCGAGAAACAATCACTCTGGCCTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029834.1-681s1c1
Sequence:CCGGGAAGAAGAATTGCTGCTTCATCTCGAGATGAAGCAGCAATTCTTCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029834.1-596s1c1
Sequence:CCGGCCTGGCTGAGTCAGATGCCATCTCGAGATGGCATCTGACTCAGCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000084216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029834.1-411s1c1
Sequence:CCGGGATGAGAACCTGGAAGTCGTTCTCGAGAACGACTTCCAGGTTCTCATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???