EMAIL THIS PAGE TO A FRIEND

PPP1R13B

protein phosphatase 1, regulatory subunit 13B

58 Gene Product Result for
Synonyms: ASPP1 p53BP2-like p85
UniProtKB ID: Q96KQ4, B2RMX5, O94870
Gene ID:
Human(23368) Summary: This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. ASPP proteins are required for the induction of apoptosis by p53-family proteins. They promote DNA binding and transactivation of p53-family proteins on the promoters of proapoptotic genes. Expression of this gene is regulated by the E2F transcription factor. [provided by RefSeq, Jul 2008]
Mouse(21981) protein phosphatase 1, regulatory (inhibitor) subunit 13B
Rat(314465) protein phosphatase 1, regulatory subunit 13B
cow(511414) protein phosphatase 1, regulatory subunit 13B
sheep(101102937) protein phosphatase 1, regulatory subunit 13B
naked mole-rat(101709202) protein phosphatase 1, regulatory subunit 13B
Domestic Rabbit(100357525) protein phosphatase 1, regulatory subunit 13B
domestic guinea pig(100723329) protein phosphatase 1, regulatory subunit 13B
chicken(423487) protein phosphatase 1, regulatory (inhibitor) subunit 13B
Horse(100060064) protein phosphatase 1, regulatory subunit 13B
domestic cat(101086154) protein phosphatase 1, regulatory subunit 13B
dog(490874) protein phosphatase 1, regulatory subunit 13B
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA006394 Anti-PPP1R13B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2101860 Anti-PPP1R13B antibody produced in rabbit affinity isolated antibody horse, mouse, rat, human, guinea pig, dog, bovine
western blot pricing
A4355 Monoclonal Anti-ASPP1 antibody produced in mouse ~2 mg/mL, clone LXO54.2, purified immunoglobulin, buffered aqueous solution mouse, human
immunoprecipitation (IP), microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015316 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015316 Rosetta Predictions human pricing
NM_001108062 Rosetta Predictions rat pricing
NM_011625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013871 predicted 352
2 SASI_Hs01_00013872 predicted 3622
3 SASI_Hs01_00013873 predicted 636
4 SASI_Hs01_00013874 predicted 2094
5 SASI_Hs02_00347584 predicted 464
6 SASI_Hs01_00013875 predicted 809
7 SASI_Hs01_00013876 predicted 3644
8 SASI_Hs01_00013877 predicted 2641
9 SASI_Hs01_00013878 predicted 1190
10 SASI_Hs01_00013879 predicted 3331
11 SASI_Hs01_00013870 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234975 predicted 3143
2 SASI_Rn02_00234976 predicted 714
3 SASI_Rn02_00234977 predicted 2938
4 SASI_Rn02_00234978 predicted 1572
5 SASI_Rn02_00234979 predicted 628
6 SASI_Rn02_00234980 predicted 2594
7 SASI_Rn02_00234981 predicted 1568
8 SASI_Rn02_00234982 predicted 1969
9 SASI_Rn02_00234983 predicted 2550
10 SASI_Rn02_00234984 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135543 predicted 877
2 SASI_Mm01_00135544 predicted 897
3 SASI_Mm01_00135545 predicted 538
4 SASI_Mm01_00135546 predicted 1003
5 SASI_Mm01_00135547 predicted 1990
6 SASI_Mm01_00135548 predicted 1136
7 SASI_Mm01_00135549 predicted 2196
8 SASI_Mm01_00135550 predicted 2914
9 SASI_Mm01_00135551 predicted 2425
10 SASI_Mm01_00135552 predicted 715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015316
VALIDATED
PPP1R13B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 13B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015316.x-1262s1c1
Sequence:CCGGGTCTCTCAGTATTGCCTCAAACTCGAGTTTGAGGCAATACTGAGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015316.x-3102s1c1
Sequence:CCGGGCCTCAACCATAAGCGACATTCTCGAGAATGTCGCTTATGGTTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015316.2-1419s21c1
Sequence:CCGGGAAGATCCAAATCCGCTAATGCTCGAGCATTAGCGGATTTGGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015316.2-2644s21c1
Sequence:CCGGGTCATCAGATGCCAATGATAACTCGAGTTATCATTGGCATCTGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015316.x-3866s1c1
Sequence:CCGGCACTCATCCTTTCTCACACTTCTCGAGAAGTGTGAGAAAGGATGAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015316.x-238s1c1
Sequence:CCGGCCTGTCGAGATGTTGTAGAATCTCGAGATTCTACAACATCTCGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015316.x-486s1c1
Sequence:CCGGCCTGGAGATAAACGTACTGAACTCGAGTTCAGTACGTTTATCTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015316.2-3721s21c1
Sequence:CCGGTTCTCCAGTTTGCCCATTAACCTCGAGGTTAATGGGCAAACTGGAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015316.2-3588s21c1
Sequence:CCGGAGCTACCAGGAGCCACTTAAGCTCGAGCTTAAGTGGCTCCTGGTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015316.2-1109s21c1
Sequence:CCGGCAGATTCGTAACCAACTTAACCTCGAGGTTAAGTTGGTTACGAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015316.2-445s21c1
Sequence:CCGGTCCCATACCCTTTGATCATATCTCGAGATATGATCAAAGGGTATGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015316.2-3756s21c1
Sequence:CCGGTCGCCTCCAAGGACTGAATTTCTCGAGAAATTCAGTCCTTGGAGGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015316
VALIDATED
PPP1R13B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 13B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015316.x-1262s1c1
Sequence:CCGGGTCTCTCAGTATTGCCTCAAACTCGAGTTTGAGGCAATACTGAGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015316.x-3102s1c1
Sequence:CCGGGCCTCAACCATAAGCGACATTCTCGAGAATGTCGCTTATGGTTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015316.2-1419s21c1
Sequence:CCGGGAAGATCCAAATCCGCTAATGCTCGAGCATTAGCGGATTTGGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015316.2-2644s21c1
Sequence:CCGGGTCATCAGATGCCAATGATAACTCGAGTTATCATTGGCATCTGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015316.x-3866s1c1
Sequence:CCGGCACTCATCCTTTCTCACACTTCTCGAGAAGTGTGAGAAAGGATGAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015316.x-238s1c1
Sequence:CCGGCCTGTCGAGATGTTGTAGAATCTCGAGATTCTACAACATCTCGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015316.x-486s1c1
Sequence:CCGGCCTGGAGATAAACGTACTGAACTCGAGTTCAGTACGTTTATCTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015316.2-3721s21c1
Sequence:CCGGTTCTCCAGTTTGCCCATTAACCTCGAGGTTAATGGGCAAACTGGAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015316.2-3588s21c1
Sequence:CCGGAGCTACCAGGAGCCACTTAAGCTCGAGCTTAAGTGGCTCCTGGTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015316.2-1109s21c1
Sequence:CCGGCAGATTCGTAACCAACTTAACCTCGAGGTTAAGTTGGTTACGAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015316.2-445s21c1
Sequence:CCGGTCCCATACCCTTTGATCATATCTCGAGATATGATCAAAGGGTATGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015316.2-3756s21c1
Sequence:CCGGTCGCCTCCAAGGACTGAATTTCTCGAGAAATTCAGTCCTTGGAGGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015316
VALIDATED
PPP1R13B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 13B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015316.x-1262s1c1
Sequence:CCGGGTCTCTCAGTATTGCCTCAAACTCGAGTTTGAGGCAATACTGAGAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015316.x-3102s1c1
Sequence:CCGGGCCTCAACCATAAGCGACATTCTCGAGAATGTCGCTTATGGTTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015316.2-1419s21c1
Sequence:CCGGGAAGATCCAAATCCGCTAATGCTCGAGCATTAGCGGATTTGGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015316.2-2644s21c1
Sequence:CCGGGTCATCAGATGCCAATGATAACTCGAGTTATCATTGGCATCTGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015316.x-3866s1c1
Sequence:CCGGCACTCATCCTTTCTCACACTTCTCGAGAAGTGTGAGAAAGGATGAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015316.x-238s1c1
Sequence:CCGGCCTGTCGAGATGTTGTAGAATCTCGAGATTCTACAACATCTCGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015316.x-486s1c1
Sequence:CCGGCCTGGAGATAAACGTACTGAACTCGAGTTCAGTACGTTTATCTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015316.2-3721s21c1
Sequence:CCGGTTCTCCAGTTTGCCCATTAACCTCGAGGTTAATGGGCAAACTGGAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015316.2-3588s21c1
Sequence:CCGGAGCTACCAGGAGCCACTTAAGCTCGAGCTTAAGTGGCTCCTGGTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015316.2-1109s21c1
Sequence:CCGGCAGATTCGTAACCAACTTAACCTCGAGGTTAAGTTGGTTACGAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015316.2-445s21c1
Sequence:CCGGTCCCATACCCTTTGATCATATCTCGAGATATGATCAAAGGGTATGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015316.2-3756s21c1
Sequence:CCGGTCGCCTCCAAGGACTGAATTTCTCGAGAAATTCAGTCCTTGGAGGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011625
PPP1R13B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 13B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011625.1-3821s1c1
Sequence:CCGGCCCTTCTTGGAAAGCCTCAAACTCGAGTTTGAGGCTTTCCAAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011625.1-1975s1c1
Sequence:CCGGGCACCTTAAATAAGTCAGTTACTCGAGTAACTGACTTATTTAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011625.1-2972s1c1
Sequence:CCGGCCACCACCATATCGTGAAGTTCTCGAGAACTTCACGATATGGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011625.1-265s1c1
Sequence:CCGGCCTGTCGAGATGTCGTAGAATCTCGAGATTCTACGACATCTCGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011625.1-944s1c1
Sequence:CCGGCCAGTCATACAATGGCAGGTTCTCGAGAACCTGCCATTGTATGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011625
PPP1R13B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 13B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011625.1-3821s1c1
Sequence:CCGGCCCTTCTTGGAAAGCCTCAAACTCGAGTTTGAGGCTTTCCAAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011625.1-1975s1c1
Sequence:CCGGGCACCTTAAATAAGTCAGTTACTCGAGTAACTGACTTATTTAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011625.1-2972s1c1
Sequence:CCGGCCACCACCATATCGTGAAGTTCTCGAGAACTTCACGATATGGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011625.1-265s1c1
Sequence:CCGGCCTGTCGAGATGTCGTAGAATCTCGAGATTCTACGACATCTCGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011625.1-944s1c1
Sequence:CCGGCCAGTCATACAATGGCAGGTTCTCGAGAACCTGCCATTGTATGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011625
PPP1R13B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 13B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011625.1-3821s1c1
Sequence:CCGGCCCTTCTTGGAAAGCCTCAAACTCGAGTTTGAGGCTTTCCAAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011625.1-1975s1c1
Sequence:CCGGGCACCTTAAATAAGTCAGTTACTCGAGTAACTGACTTATTTAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011625.1-2972s1c1
Sequence:CCGGCCACCACCATATCGTGAAGTTCTCGAGAACTTCACGATATGGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011625.1-265s1c1
Sequence:CCGGCCTGTCGAGATGTCGTAGAATCTCGAGATTCTACGACATCTCGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011625.1-944s1c1
Sequence:CCGGCCAGTCATACAATGGCAGGTTCTCGAGAACCTGCCATTGTATGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)