EMAIL THIS PAGE TO A FRIEND

PPP1R13L

protein phosphatase 1, regulatory subunit 13 like

64 Gene Product Result for
Synonyms: IASPP NKIP1 RAI RAI4
Gene ID:
Human(10848) Summary: IASPP is one of the most evolutionarily conserved inhibitors of p53 (TP53; MIM 191170), whereas ASPP1 (MIM 606455) and ASPP2 (MIM 602143) are activators of p53.[supplied by OMIM, Mar 2008]
Mouse(333654) protein phosphatase 1, regulatory (inhibitor) subunit 13 like
Rat(686781) protein phosphatase 1, regulatory subunit 13 like
Zebrafish(541507) protein phosphatase 1, regulatory (inhibitor) subunit 13 like
dog(612286) protein phosphatase 1, regulatory subunit 13 like
domestic cat(101083727) protein phosphatase 1, regulatory subunit 13 like
domestic guinea pig(100733859) protein phosphatase 1, regulatory subunit 13 like
naked mole-rat(101699368) protein phosphatase 1, regulatory subunit 13 like
cow(505818) protein phosphatase 1, regulatory subunit 13 like
sheep(101116596) protein phosphatase 1, regulatory subunit 13 like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_289718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_289718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_289718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086721 MISSION® esiRNA esiRNA human PPP1R13L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006663 Rosetta Predictions human pricing
XM_001075705 Rosetta Predictions rat pricing
NM_001010836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142991 predicted 2604
2 SASI_Hs01_00142992 predicted 2713
3 SASI_Hs02_00342048 predicted 2037
4 SASI_Hs01_00142994 predicted 2065
5 SASI_Hs01_00142995 predicted 2077
6 SASI_Hs01_00142996 predicted 2060
7 SASI_Hs01_00142997 predicted 264
8 SASI_Hs01_00142998 predicted 2480
9 SASI_Hs01_00142999 predicted 1869
10 SASI_Hs02_00342049 predicted 2295
11 SASI_Hs01_00142990 predicted 2350
12 SASI_Hs01_00142993 predicted 2789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350751 predicted 898
2 SASI_Rn02_00350752 predicted 2313
3 SASI_Rn02_00350753 predicted 2542
4 SASI_Rn02_00350754 predicted 2504
5 SASI_Rn02_00350755 predicted 2652
6 SASI_Rn02_00350756 predicted 1901
7 SASI_Rn02_00350757 predicted 2568
8 SASI_Rn02_00350758 predicted 2662
9 SASI_Rn02_00350759 predicted 1711
10 SASI_Rn02_00350760 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286906 predicted 921
2 SASI_Mm02_00286907 predicted 488
3 SASI_Mm01_00137195 predicted 2314
4 SASI_Mm01_00137196 predicted 233
5 SASI_Mm02_00286908 predicted 2530
6 SASI_Mm02_00286909 predicted 2598
7 SASI_Mm01_00137197 predicted 2343
8 SASI_Mm02_00286910 predicted 879
9 SASI_Mm01_00137198 predicted 263
10 SASI_Mm01_00137200 predicted 253
11 SASI_Mm01_00137194 predicted 225
12 SASI_Mm01_00137199 predicted 216
13 SASI_Mm01_00137201 predicted 417
14 SASI_Mm01_00137202 predicted 347
15 SASI_Mm01_00137203 predicted 493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006663
VALIDATED
PPP1R13L MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 13 like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006663.3-1685s21c1
Sequence:CCGGCCCTACCCACAAGAAACAGTACTCGAGTACTGTTTCTTGTGGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006663.3-2510s21c1
Sequence:CCGGGCGGAACTACTTCGGGCTGTTCTCGAGAACAGCCCGAAGTAGTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006663.1-1120s1c1
Sequence:CCGGCCCTACCCACAAGAAACAGTACTCGAGTACTGTTTCTTGTGGGTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006663.1-1945s1c1
Sequence:CCGGGCGGAACTACTTCGGGCTGTTCTCGAGAACAGCCCGAAGTAGTTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006663.1-1978s1c1
Sequence:CCGGGCCTCAAAGGAGTAAAGTCTACTCGAGTAGACTTTACTCCTTTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006663.1-1524s1c1
Sequence:CCGGCCAACTACTCTATCGTGGATTCTCGAGAATCCACGATAGAGTAGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006663.3-2089s21c1
Sequence:CCGGCCAACTACTCTATCGTGGATTCTCGAGAATCCACGATAGAGTAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006663.3-2543s21c1
Sequence:CCGGGCCTCAAAGGAGTAAAGTCTACTCGAGTAGACTTTACTCCTTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006663
VALIDATED
PPP1R13L MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 13 like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006663.3-1685s21c1
Sequence:CCGGCCCTACCCACAAGAAACAGTACTCGAGTACTGTTTCTTGTGGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006663.3-2510s21c1
Sequence:CCGGGCGGAACTACTTCGGGCTGTTCTCGAGAACAGCCCGAAGTAGTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006663.1-1120s1c1
Sequence:CCGGCCCTACCCACAAGAAACAGTACTCGAGTACTGTTTCTTGTGGGTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006663.1-1945s1c1
Sequence:CCGGGCGGAACTACTTCGGGCTGTTCTCGAGAACAGCCCGAAGTAGTTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006663.1-1978s1c1
Sequence:CCGGGCCTCAAAGGAGTAAAGTCTACTCGAGTAGACTTTACTCCTTTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006663.1-1524s1c1
Sequence:CCGGCCAACTACTCTATCGTGGATTCTCGAGAATCCACGATAGAGTAGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006663.3-2089s21c1
Sequence:CCGGCCAACTACTCTATCGTGGATTCTCGAGAATCCACGATAGAGTAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006663.3-2543s21c1
Sequence:CCGGGCCTCAAAGGAGTAAAGTCTACTCGAGTAGACTTTACTCCTTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006663
VALIDATED
PPP1R13L MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 13 like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006663.3-1685s21c1
Sequence:CCGGCCCTACCCACAAGAAACAGTACTCGAGTACTGTTTCTTGTGGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006663.3-2510s21c1
Sequence:CCGGGCGGAACTACTTCGGGCTGTTCTCGAGAACAGCCCGAAGTAGTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006663.1-1120s1c1
Sequence:CCGGCCCTACCCACAAGAAACAGTACTCGAGTACTGTTTCTTGTGGGTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006663.1-1945s1c1
Sequence:CCGGGCGGAACTACTTCGGGCTGTTCTCGAGAACAGCCCGAAGTAGTTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006663.1-1978s1c1
Sequence:CCGGGCCTCAAAGGAGTAAAGTCTACTCGAGTAGACTTTACTCCTTTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006663.1-1524s1c1
Sequence:CCGGCCAACTACTCTATCGTGGATTCTCGAGAATCCACGATAGAGTAGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006663.3-2089s21c1
Sequence:CCGGCCAACTACTCTATCGTGGATTCTCGAGAATCCACGATAGAGTAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006663.3-2543s21c1
Sequence:CCGGGCCTCAAAGGAGTAAAGTCTACTCGAGTAGACTTTACTCCTTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_289718
VALIDATED
PPP1R13L MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 13 like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-2199s1c1
Sequence:CCGGCCCAGACTGAAGATTAGGAAACTCGAGTTTCCTAATCTTCAGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-1179s1c1
Sequence:CCGGCAAGAAACAATACCAACAGATCTCGAGATCTGTTGGTATTGTTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-1995s1c1
Sequence:CCGGGCGCAACTACTTCGGGCTCTTCTCGAGAAGAGCCCGAAGTAGTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-1174s1c1
Sequence:CCGGACCCACAAGAAACAATACCAACTCGAGTTGGTATTGTTTCTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-727s1c1
Sequence:CCGGCCACGCAATTACAAGGTGTCTCTCGAGAGACACCTTGTAATTGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_289718
VALIDATED
PPP1R13L MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 13 like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-2199s1c1
Sequence:CCGGCCCAGACTGAAGATTAGGAAACTCGAGTTTCCTAATCTTCAGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-1179s1c1
Sequence:CCGGCAAGAAACAATACCAACAGATCTCGAGATCTGTTGGTATTGTTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-1995s1c1
Sequence:CCGGGCGCAACTACTTCGGGCTCTTCTCGAGAAGAGCCCGAAGTAGTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-1174s1c1
Sequence:CCGGACCCACAAGAAACAATACCAACTCGAGTTGGTATTGTTTCTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-727s1c1
Sequence:CCGGCCACGCAATTACAAGGTGTCTCTCGAGAGACACCTTGTAATTGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_289718
VALIDATED
PPP1R13L MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 13 like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-2199s1c1
Sequence:CCGGCCCAGACTGAAGATTAGGAAACTCGAGTTTCCTAATCTTCAGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-1179s1c1
Sequence:CCGGCAAGAAACAATACCAACAGATCTCGAGATCTGTTGGTATTGTTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-1995s1c1
Sequence:CCGGGCGCAACTACTTCGGGCTCTTCTCGAGAAGAGCCCGAAGTAGTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-1174s1c1
Sequence:CCGGACCCACAAGAAACAATACCAACTCGAGTTGGTATTGTTTCTTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_289718.2-727s1c1
Sequence:CCGGCCACGCAATTACAAGGTGTCTCTCGAGAGACACCTTGTAATTGCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)