EMAIL THIS PAGE TO A FRIEND

PPP1R14B

protein phosphatase 1, regulatory (inhibitor) subunit 14B

77 Gene Product Result for
Synonyms: PHI-1 PLCB3N PNG SOM172
UniProtKB ID: Q96C90, Q504S7, Q7KZD7
Gene ID:
Mouse(18938) protein phosphatase 1, regulatory (inhibitor) subunit 14B
Rat(259225) protein phosphatase 1, regulatory (inhibitor) subunit 14B
domestic cat(101092711) protein phosphatase 1, regulatory (inhibitor) subunit 14B
dog(476035) protein phosphatase 1, regulatory (inhibitor) subunit 14B
domestic guinea pig(100733874) protein phosphatase 1, regulatory (inhibitor) subunit 14B
naked mole-rat(101698637) protein phosphatase 1, regulatory (inhibitor) subunit 14B
cow(617154) protein phosphatase 1, regulatory (inhibitor) subunit 14B
sheep(101102599) protein phosphatase 1, regulatory (inhibitor) subunit 14B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_370630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370630 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138689 Rosetta Predictions human pricing
NM_172045 Rosetta Predictions rat pricing
NM_008889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094319 predicted 603
2 SASI_Hs01_00094322 predicted 606
3 SASI_Hs01_00094324 predicted 602
4 SASI_Hs01_00094326 predicted 548
5 SASI_Hs02_00363782 predicted 533
6 SASI_Hs01_00094318 predicted 727
7 SASI_Hs01_00094320 predicted 611
8 SASI_Hs01_00094321 predicted 638
9 SASI_Hs01_00094325 predicted 755
10 SASI_Hs01_00094327 predicted 589
11 SASI_Hs01_00094323 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039923 predicted 311
2 SASI_Rn01_00039924 predicted 494
3 SASI_Rn01_00039925 predicted 461
4 SASI_Rn01_00039926 predicted 362
5 SASI_Rn01_00039927 predicted 204
6 SASI_Rn01_00039928 predicted 439
7 SASI_Rn01_00039929 predicted 310
8 SASI_Rn01_00039930 predicted 378
9 SASI_Rn01_00039931 predicted 161
10 SASI_Rn02_00269154 predicted 500
11 SASI_Rn01_00039922 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153920 predicted 440
2 SASI_Mm01_00153921 predicted 403
3 SASI_Mm02_00314894 predicted 473
4 SASI_Mm02_00314895 predicted 356
5 SASI_Mm01_00153926 predicted 499
6 SASI_Mm02_00314896 predicted 631
7 SASI_Mm01_00153927 predicted 456
8 SASI_Mm01_00153928 predicted 691
9 SASI_Mm02_00314897 predicted 401
10 SASI_Mm02_00314898 predicted 695
11 SASI_Mm01_00153922 predicted 551
12 SASI_Mm01_00153923 predicted 366
13 SASI_Mm01_00153924 predicted 546
14 SASI_Mm01_00153925 predicted 554
15 SASI_Mm01_00153929 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008889
VALIDATED
PPP1R14B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 14B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008889.1-543s1c1
Sequence:CCGGCGAGATAGATGTGGATGAACTCTCGAGAGTTCATCCACATCTATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008889.1-609s1c1
Sequence:CCGGGCTGTTAGTTGACTGCTACAACTCGAGTTGTAGCAGTCAACTAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008889.2-360s21c1
Sequence:CCGGAGGGAAGGTCACCGTCAAGTACTCGAGTACTTGACGGTGACCTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008889.2-407s21c1
Sequence:CCGGTCAACCTGGAGGAGTGGATTTCTCGAGAAATCCACTCCTCCAGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008889.2-429s21c1
Sequence:CCGGAGAACAGCTCACGCGACTCTACTCGAGTAGAGTCGCGTGAGCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008889.2-504s21c1
Sequence:CCGGAGACATGGAGAGTGATGATACCTCGAGGTATCATCACTCTCCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008889
VALIDATED
PPP1R14B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 14B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008889.1-543s1c1
Sequence:CCGGCGAGATAGATGTGGATGAACTCTCGAGAGTTCATCCACATCTATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008889.1-609s1c1
Sequence:CCGGGCTGTTAGTTGACTGCTACAACTCGAGTTGTAGCAGTCAACTAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008889.2-360s21c1
Sequence:CCGGAGGGAAGGTCACCGTCAAGTACTCGAGTACTTGACGGTGACCTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008889.2-407s21c1
Sequence:CCGGTCAACCTGGAGGAGTGGATTTCTCGAGAAATCCACTCCTCCAGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008889.2-429s21c1
Sequence:CCGGAGAACAGCTCACGCGACTCTACTCGAGTAGAGTCGCGTGAGCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008889.2-504s21c1
Sequence:CCGGAGACATGGAGAGTGATGATACCTCGAGGTATCATCACTCTCCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008889
VALIDATED
PPP1R14B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 14B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008889.1-543s1c1
Sequence:CCGGCGAGATAGATGTGGATGAACTCTCGAGAGTTCATCCACATCTATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008889.1-609s1c1
Sequence:CCGGGCTGTTAGTTGACTGCTACAACTCGAGTTGTAGCAGTCAACTAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008889.2-360s21c1
Sequence:CCGGAGGGAAGGTCACCGTCAAGTACTCGAGTACTTGACGGTGACCTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008889.2-407s21c1
Sequence:CCGGTCAACCTGGAGGAGTGGATTTCTCGAGAAATCCACTCCTCCAGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008889.2-429s21c1
Sequence:CCGGAGAACAGCTCACGCGACTCTACTCGAGTAGAGTCGCGTGAGCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008889.2-504s21c1
Sequence:CCGGAGACATGGAGAGTGATGATACCTCGAGGTATCATCACTCTCCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370630
VALIDATED
PPP1R14B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 14B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_370630.1-823s1c1
Sequence:CCGGCTGCTGGTTGACTGTTACAAACTCGAGTTTGTAACAGTCAACCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370630.1-90s1c1
Sequence:CCGGAGAGGGAGAGTCAGAAAGAATCTCGAGATTCTTTCTGACTCTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370630.1-205s1c1
Sequence:CCGGAGCGAGACAGAGAAAGCGCTTCTCGAGAAGCGCTTTCTCTGTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_370630.1-648s1c1
Sequence:CCGGCGTCAAGTATGACCGCAAGGACTCGAGTCCTTGCGGTCATACTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_370630.1-681s1c1
Sequence:CCGGCCTCAACCTAGAGGAGTGGATCTCGAGATCCACTCCTCTAGGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370630
VALIDATED
PPP1R14B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 14B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_370630.1-823s1c1
Sequence:CCGGCTGCTGGTTGACTGTTACAAACTCGAGTTTGTAACAGTCAACCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370630.1-90s1c1
Sequence:CCGGAGAGGGAGAGTCAGAAAGAATCTCGAGATTCTTTCTGACTCTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370630.1-205s1c1
Sequence:CCGGAGCGAGACAGAGAAAGCGCTTCTCGAGAAGCGCTTTCTCTGTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_370630.1-648s1c1
Sequence:CCGGCGTCAAGTATGACCGCAAGGACTCGAGTCCTTGCGGTCATACTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_370630.1-681s1c1
Sequence:CCGGCCTCAACCTAGAGGAGTGGATCTCGAGATCCACTCCTCTAGGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370630
VALIDATED
PPP1R14B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 14B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_370630.1-823s1c1
Sequence:CCGGCTGCTGGTTGACTGTTACAAACTCGAGTTTGTAACAGTCAACCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370630.1-90s1c1
Sequence:CCGGAGAGGGAGAGTCAGAAAGAATCTCGAGATTCTTTCTGACTCTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370630.1-205s1c1
Sequence:CCGGAGCGAGACAGAGAAAGCGCTTCTCGAGAAGCGCTTTCTCTGTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_370630.1-648s1c1
Sequence:CCGGCGTCAAGTATGACCGCAAGGACTCGAGTCCTTGCGGTCATACTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_370630.1-681s1c1
Sequence:CCGGCCTCAACCTAGAGGAGTGGATCTCGAGATCCACTCCTCTAGGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)