EMAIL THIS PAGE TO A FRIEND

PPP1R14D

protein phosphatase 1, regulatory (inhibitor) subunit 14D

69 Gene Product Result for
Synonyms: CPI17-like GBPI-1 GBPI1
UniProtKB ID: Q9NXH3, Q4V773
Gene ID:
Human(54866) Summary: Protein phosphatase-1 (PP1; see MIM 176875) is a major cellular phosphatase that reverses serine/threonine protein phosphorylation. PPP1R14D is a PP1 inhibitor that itself is regulated by phosphorylation (Liu et al., 2004 [PubMed 12974676]
Mouse(72112) protein phosphatase 1, regulatory (inhibitor) subunit 14D
Rat(259226) protein phosphatase 1, regulatory (inhibitor) subunit 14D
domestic guinea pig(100717958) protein phosphatase 1, regulatory (inhibitor) subunit 14D
naked mole-rat(101719903) protein phosphatase 1, regulatory (inhibitor) subunit 14D
cow(617670) protein phosphatase 1, regulatory (inhibitor) subunit 14D
sheep(101111024) protein phosphatase 1, regulatory (inhibitor) subunit 14D
chicken(423205) protein phosphatase 1, regulatory (inhibitor) subunit 14D
domestic cat(101087748) protein phosphatase 1, regulatory (inhibitor) subunit 14D
dog(487500) protein phosphatase 1, regulatory (inhibitor) subunit 14D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028104 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028104 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028104 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU057531 MISSION® esiRNA esiRNA targeting mouse Ppp1r14d (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017726 Rosetta Predictions human pricing
NM_172011 Rosetta Predictions rat pricing
NM_028104 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199594 predicted 504
2 SASI_Hs01_00199595 predicted 414
3 SASI_Hs01_00199596 predicted 511
4 SASI_Hs01_00199597 predicted 537
5 SASI_Hs01_00199598 predicted 308
6 SASI_Hs01_00199599 predicted 467
7 SASI_Hs01_00199600 predicted 528
8 SASI_Hs01_00199601 predicted 309
9 SASI_Hs01_00199602 predicted 478
10 SASI_Hs01_00199603 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120325 predicted 401
2 SASI_Rn01_00120326 predicted 323
3 SASI_Rn01_00120327 predicted 367
4 SASI_Rn01_00120328 predicted 333
5 SASI_Rn01_00120329 predicted 295
6 SASI_Rn01_00120331 predicted 423
7 SASI_Rn01_00120332 predicted 280
8 SASI_Rn01_00120333 predicted 469
9 SASI_Rn01_00120334 predicted 356
10 SASI_Rn02_00269101 predicted 299
11 SASI_Rn01_00120330 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118582 predicted 422
2 SASI_Mm01_00118583 predicted 310
3 SASI_Mm01_00118584 predicted 356
4 SASI_Mm01_00118585 predicted 447
5 SASI_Mm01_00118586 predicted 280
6 SASI_Mm02_00333346 predicted 329
7 SASI_Mm01_00118587 predicted 358
8 SASI_Mm01_00118588 predicted 449
9 SASI_Mm01_00118590 predicted 346
10 SASI_Mm01_00118591 predicted 449
11 SASI_Mm01_00118589 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017726
PPP1R14D MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 14D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017726.7-589s21c1
Sequence:CCGGCTTGGGACACAAACAAGAAATCTCGAGATTTCTTGTTTGTGTCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017726.7-359s21c1
Sequence:CCGGGGAAGCTCTCATGGATCTATCCTCGAGGATAGATCCATGAGAGCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017726.x-385s1c1
Sequence:CCGGCTGGAAGCTCTCATGGATCTACTCGAGTAGATCCATGAGAGCTTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017726.x-658s1c1
Sequence:CCGGGCATACTCCTACTGTCTGTGTCTCGAGACACAGACAGTAGGAGTATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017726.x-316s1c1
Sequence:CCGGCAATGGGTGGATGCTCAAGTTCTCGAGAACTTGAGCATCCACCCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017726.x-189s1c1
Sequence:CCGGGACATCATCCACAGACTCAGACTCGAGTCTGAGTCTGTGGATGATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017726.7-564s21c1
Sequence:CCGGATCCTGGCTAAGAGGGAAATACTCGAGTATTTCCCTCTTAGCCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017726.7-504s21c1
Sequence:CCGGTAAGCCTGAGAGACCATCTTTCTCGAGAAAGATGGTCTCTCAGGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017726.x-373s1c1
Sequence:CCGGCCTGAGATTGACCTGGAAGCTCTCGAGAGCTTCCAGGTCAATCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017726
PPP1R14D MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 14D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017726.7-589s21c1
Sequence:CCGGCTTGGGACACAAACAAGAAATCTCGAGATTTCTTGTTTGTGTCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017726.7-359s21c1
Sequence:CCGGGGAAGCTCTCATGGATCTATCCTCGAGGATAGATCCATGAGAGCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017726.x-385s1c1
Sequence:CCGGCTGGAAGCTCTCATGGATCTACTCGAGTAGATCCATGAGAGCTTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017726.x-658s1c1
Sequence:CCGGGCATACTCCTACTGTCTGTGTCTCGAGACACAGACAGTAGGAGTATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017726.x-316s1c1
Sequence:CCGGCAATGGGTGGATGCTCAAGTTCTCGAGAACTTGAGCATCCACCCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017726.x-189s1c1
Sequence:CCGGGACATCATCCACAGACTCAGACTCGAGTCTGAGTCTGTGGATGATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017726.7-564s21c1
Sequence:CCGGATCCTGGCTAAGAGGGAAATACTCGAGTATTTCCCTCTTAGCCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017726.7-504s21c1
Sequence:CCGGTAAGCCTGAGAGACCATCTTTCTCGAGAAAGATGGTCTCTCAGGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017726.x-373s1c1
Sequence:CCGGCCTGAGATTGACCTGGAAGCTCTCGAGAGCTTCCAGGTCAATCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017726
PPP1R14D MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 14D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017726.7-589s21c1
Sequence:CCGGCTTGGGACACAAACAAGAAATCTCGAGATTTCTTGTTTGTGTCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017726.7-359s21c1
Sequence:CCGGGGAAGCTCTCATGGATCTATCCTCGAGGATAGATCCATGAGAGCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017726.x-385s1c1
Sequence:CCGGCTGGAAGCTCTCATGGATCTACTCGAGTAGATCCATGAGAGCTTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017726.x-658s1c1
Sequence:CCGGGCATACTCCTACTGTCTGTGTCTCGAGACACAGACAGTAGGAGTATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017726.x-316s1c1
Sequence:CCGGCAATGGGTGGATGCTCAAGTTCTCGAGAACTTGAGCATCCACCCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017726.x-189s1c1
Sequence:CCGGGACATCATCCACAGACTCAGACTCGAGTCTGAGTCTGTGGATGATGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017726.7-564s21c1
Sequence:CCGGATCCTGGCTAAGAGGGAAATACTCGAGTATTTCCCTCTTAGCCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017726.7-504s21c1
Sequence:CCGGTAAGCCTGAGAGACCATCTTTCTCGAGAAAGATGGTCTCTCAGGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017726.x-373s1c1
Sequence:CCGGCCTGAGATTGACCTGGAAGCTCTCGAGAGCTTCCAGGTCAATCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028104
PPP1R14D MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 14D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-345s1c1
Sequence:CCGGCCAGAGATTGATCTGGAAGCTCTCGAGAGCTTCCAGATCAATCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-333s1c1
Sequence:CCGGGAATCTTCTGAGCCAGAGATTCTCGAGAATCTCTGGCTCAGAAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-372s1c1
Sequence:CCGGGACTTGTCAACAGAAGATCAACTCGAGTTGATCTTCTGTTGACAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-363s1c1
Sequence:CCGGGCTCTCATGGACTTGTCAACACTCGAGTGTTGACAAGTCCATGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-182s1c1
Sequence:CCGGGTCAAAGACTCACTTGGACATCTCGAGATGTCCAAGTGAGTCTTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028104
PPP1R14D MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 14D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-345s1c1
Sequence:CCGGCCAGAGATTGATCTGGAAGCTCTCGAGAGCTTCCAGATCAATCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-333s1c1
Sequence:CCGGGAATCTTCTGAGCCAGAGATTCTCGAGAATCTCTGGCTCAGAAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-372s1c1
Sequence:CCGGGACTTGTCAACAGAAGATCAACTCGAGTTGATCTTCTGTTGACAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-363s1c1
Sequence:CCGGGCTCTCATGGACTTGTCAACACTCGAGTGTTGACAAGTCCATGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-182s1c1
Sequence:CCGGGTCAAAGACTCACTTGGACATCTCGAGATGTCCAAGTGAGTCTTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028104
PPP1R14D MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 14D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-345s1c1
Sequence:CCGGCCAGAGATTGATCTGGAAGCTCTCGAGAGCTTCCAGATCAATCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-333s1c1
Sequence:CCGGGAATCTTCTGAGCCAGAGATTCTCGAGAATCTCTGGCTCAGAAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-372s1c1
Sequence:CCGGGACTTGTCAACAGAAGATCAACTCGAGTTGATCTTCTGTTGACAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-363s1c1
Sequence:CCGGGCTCTCATGGACTTGTCAACACTCGAGTGTTGACAAGTCCATGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028104.2-182s1c1
Sequence:CCGGGTCAAAGACTCACTTGGACATCTCGAGATGTCCAAGTGAGTCTTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)