EMAIL THIS PAGE TO A FRIEND

PPP1R15A

protein phosphatase 1, regulatory subunit 15A

50 Gene Product Result for
Synonyms: GADD34
UniProtKB ID: O75807, Q6IA96, Q9NVU6
Gene ID:
Human(23645) Summary: This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The induction of this gene by ionizing radiation occurs in certain cell lines regardless of p53 status, and its protein response is correlated with apoptosis following ionizing radiation. [provided by RefSeq, Jul 2008]
Mouse(17872) protein phosphatase 1, regulatory (inhibitor) subunit 15A
Rat(171071) protein phosphatase 1, regulatory subunit 15A
Zebrafish(797943) protein phosphatase 1, regulatory subunit 15A
dog(476419) protein phosphatase 1, regulatory subunit 15A
domestic cat(101084589) protein phosphatase 1, regulatory subunit 15A
cow(514688) protein phosphatase 1, regulatory subunit 15A
sheep(101102415) protein phosphatase 1, regulatory subunit 15A
naked mole-rat(101715557) protein phosphatase 1, regulatory subunit 15A
domestic guinea pig(100727559) protein phosphatase 1, regulatory subunit 15A
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014330 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014330 Rosetta Predictions human pricing
NM_133546 Rosetta Predictions rat pricing
NM_008654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345455 predicted 686
2 SASI_Hs01_00237406 predicted 1921
3 SASI_Hs02_00345456 predicted 1391
4 SASI_Hs01_00237409 predicted 1402
5 SASI_Hs02_00345457 predicted 1427
6 SASI_Hs01_00237410 predicted 1621
7 SASI_Hs01_00237414 predicted 770
8 SASI_Hs02_00345458 predicted 442
9 SASI_Hs02_00345459 predicted 1410
10 SASI_Hs02_00345460 predicted 1930
11 SASI_Hs01_00237405 predicted 692
12 SASI_Hs01_00237407 predicted 779
13 SASI_Hs01_00237408 predicted 609
14 SASI_Hs01_00237411 predicted 1262
15 SASI_Hs01_00237412 predicted 839
16 SASI_Hs01_00237413 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104828 predicted 1564
2 SASI_Rn01_00104829 predicted 1387
3 SASI_Rn01_00104831 predicted 1582
4 SASI_Rn01_00104832 predicted 558
5 SASI_Rn02_00267735 predicted 1602
6 SASI_Rn01_00104833 predicted 861
7 SASI_Rn01_00104834 predicted 1669
8 SASI_Rn01_00104835 predicted 364
9 SASI_Rn01_00104836 predicted 1101
10 SASI_Rn01_00104837 predicted 1218
11 SASI_Rn01_00104830 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192455 predicted 1182
2 SASI_Mm01_00192456 predicted 538
3 SASI_Mm02_00314407 predicted 1571
4 SASI_Mm01_00192459 predicted 763
5 SASI_Mm02_00314408 predicted 854
6 SASI_Mm01_00192460 predicted 1123
7 SASI_Mm01_00192461 predicted 1734
8 SASI_Mm01_00192462 predicted 1880
9 SASI_Mm01_00192457 predicted 1533
10 SASI_Mm01_00192458 predicted 1626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014330
VALIDATED
PPP1R15A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 15A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014330.x-1582s1c1
Sequence:CCGGGTGGATAGTGAGGATAAGGAACTCGAGTTCCTTATCCTCACTATCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-953s21c1
Sequence:CCGGGAATCAAGCCACGGAGGATAACTCGAGTTATCCTCCGTGGCTTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-848s21c1
Sequence:CCGGGGACGATGAAGAAGCTGTAAACTCGAGTTTACAGCTTCTTCATCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014330.x-1917s1c1
Sequence:CCGGCGAGAAGGTCACTGTCCATTTCTCGAGAAATGGACAGTGACCTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-1423s21c1
Sequence:GTACCGGTCTTGAAGTCCTGGGTCTATCCTCGAGGATAGACCCAGGACTTCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-694s21c1
Sequence:GTACCGGTGTCTCCCAGCCTTCTGATAACTCGAGTTATCAGAAGGCTGGGAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014330.x-1444s1c1
Sequence:CCGGGATGAGGACAGTGATACAGGACTCGAGTCCTGTATCACTGTCCTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014330.x-687s1c1
Sequence:CCGGGACACTGCAAGGTTCTGATAACTCGAGTTATCAGAACCTTGCAGTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014330.x-1468s1c1
Sequence:CCGGGCCGAGGATGAAAGAGAAGCTCTCGAGAGCTTCTCTTTCATCCTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-774s21c1
Sequence:GTACCGGGCTGAAGAGGAGGGAGTTAACCTCGAGGTTAACTCCCTCCTCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-1282s21c1
Sequence:CCGGTCCTGAAGGCCTGGGTGTATTCTCGAGAATACACCCAGGCCTTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-1473s21c1
Sequence:CCGGGATGAGGACAGTGATACAGGACTCGAGTCCTGTATCACTGTCCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-650s21c1
Sequence:CCGGTAGAGGGCAGGGAAGTCAATTCTCGAGAATTGACTTCCCTGCCCTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014330
VALIDATED
PPP1R15A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 15A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014330.x-1582s1c1
Sequence:CCGGGTGGATAGTGAGGATAAGGAACTCGAGTTCCTTATCCTCACTATCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-953s21c1
Sequence:CCGGGAATCAAGCCACGGAGGATAACTCGAGTTATCCTCCGTGGCTTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-848s21c1
Sequence:CCGGGGACGATGAAGAAGCTGTAAACTCGAGTTTACAGCTTCTTCATCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014330.x-1917s1c1
Sequence:CCGGCGAGAAGGTCACTGTCCATTTCTCGAGAAATGGACAGTGACCTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-1423s21c1
Sequence:GTACCGGTCTTGAAGTCCTGGGTCTATCCTCGAGGATAGACCCAGGACTTCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-694s21c1
Sequence:GTACCGGTGTCTCCCAGCCTTCTGATAACTCGAGTTATCAGAAGGCTGGGAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014330.x-1444s1c1
Sequence:CCGGGATGAGGACAGTGATACAGGACTCGAGTCCTGTATCACTGTCCTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014330.x-687s1c1
Sequence:CCGGGACACTGCAAGGTTCTGATAACTCGAGTTATCAGAACCTTGCAGTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014330.x-1468s1c1
Sequence:CCGGGCCGAGGATGAAAGAGAAGCTCTCGAGAGCTTCTCTTTCATCCTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-774s21c1
Sequence:GTACCGGGCTGAAGAGGAGGGAGTTAACCTCGAGGTTAACTCCCTCCTCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-1282s21c1
Sequence:CCGGTCCTGAAGGCCTGGGTGTATTCTCGAGAATACACCCAGGCCTTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-1473s21c1
Sequence:CCGGGATGAGGACAGTGATACAGGACTCGAGTCCTGTATCACTGTCCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-650s21c1
Sequence:CCGGTAGAGGGCAGGGAAGTCAATTCTCGAGAATTGACTTCCCTGCCCTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014330
VALIDATED
PPP1R15A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 15A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014330.x-1582s1c1
Sequence:CCGGGTGGATAGTGAGGATAAGGAACTCGAGTTCCTTATCCTCACTATCCACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-953s21c1
Sequence:CCGGGAATCAAGCCACGGAGGATAACTCGAGTTATCCTCCGTGGCTTGATTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-848s21c1
Sequence:CCGGGGACGATGAAGAAGCTGTAAACTCGAGTTTACAGCTTCTTCATCGTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014330.x-1917s1c1
Sequence:CCGGCGAGAAGGTCACTGTCCATTTCTCGAGAAATGGACAGTGACCTTCTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-1423s21c1
Sequence:GTACCGGTCTTGAAGTCCTGGGTCTATCCTCGAGGATAGACCCAGGACTTCAAGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-694s21c1
Sequence:GTACCGGTGTCTCCCAGCCTTCTGATAACTCGAGTTATCAGAAGGCTGGGAGACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014330.x-1444s1c1
Sequence:CCGGGATGAGGACAGTGATACAGGACTCGAGTCCTGTATCACTGTCCTCATCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014330.x-687s1c1
Sequence:CCGGGACACTGCAAGGTTCTGATAACTCGAGTTATCAGAACCTTGCAGTGTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000003043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014330.x-1468s1c1
Sequence:CCGGGCCGAGGATGAAAGAGAAGCTCTCGAGAGCTTCTCTTTCATCCTCGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000382135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-774s21c1
Sequence:GTACCGGGCTGAAGAGGAGGGAGTTAACCTCGAGGTTAACTCCCTCCTCTTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-1282s21c1
Sequence:CCGGTCCTGAAGGCCTGGGTGTATTCTCGAGAATACACCCAGGCCTTCAGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-1473s21c1
Sequence:CCGGGATGAGGACAGTGATACAGGACTCGAGTCCTGTATCACTGTCCTCATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000320580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014330.3-650s21c1
Sequence:CCGGTAGAGGGCAGGGAAGTCAATTCTCGAGAATTGACTTCCCTGCCCTCTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008654
VALIDATED
PPP1R15A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 15A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008654.1-1726s21c1
Sequence:CCGGTTCCAGGTGGCCTTCTATTTACTCGAGTAAATAGAAGGCCACCTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008654.1-1299s1c1
Sequence:CCGGCCATACAAGTGCCTTCCTGAACTCGAGTTCAGGAAGGCACTTGTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008654.1-551s21c1
Sequence:CCGGCAAATGTTGATGAGTACAATGCTCGAGCATTGTACTCATCAACATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008654.1-1737s1c1
Sequence:CCGGCTTCTATTTACCCGGAGAGAACTCGAGTTCTCTCCGGGTAAATAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008654.1-1805s21c1
Sequence:CCGGGGCGGCTCAGATTGTTCAAAGCTCGAGCTTTGAACAATCTGAGCCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008654.1-800s21c1
Sequence:CCGGCCATAGCTCCGGGATACAAACCTCGAGGTTTGTATCCCGGAGCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008654.1-1883s1c1
Sequence:CCGGCTGAGAAAGTCACAGTCCATTCTCGAGAATGGACTGTGACTTTCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008654.1-1126s1c1
Sequence:CCGGGAAGACAACAGCGATTCGGATCTCGAGATCCGAATCGCTGTTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008654.1-1883s21c1
Sequence:CCGGCTGAGAAAGTCACAGTCCATTCTCGAGAATGGACTGTGACTTTCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008654
VALIDATED
PPP1R15A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 15A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008654.1-1726s21c1
Sequence:CCGGTTCCAGGTGGCCTTCTATTTACTCGAGTAAATAGAAGGCCACCTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008654.1-1299s1c1
Sequence:CCGGCCATACAAGTGCCTTCCTGAACTCGAGTTCAGGAAGGCACTTGTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008654.1-551s21c1
Sequence:CCGGCAAATGTTGATGAGTACAATGCTCGAGCATTGTACTCATCAACATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008654.1-1737s1c1
Sequence:CCGGCTTCTATTTACCCGGAGAGAACTCGAGTTCTCTCCGGGTAAATAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008654.1-1805s21c1
Sequence:CCGGGGCGGCTCAGATTGTTCAAAGCTCGAGCTTTGAACAATCTGAGCCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008654.1-800s21c1
Sequence:CCGGCCATAGCTCCGGGATACAAACCTCGAGGTTTGTATCCCGGAGCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008654.1-1883s1c1
Sequence:CCGGCTGAGAAAGTCACAGTCCATTCTCGAGAATGGACTGTGACTTTCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008654.1-1126s1c1
Sequence:CCGGGAAGACAACAGCGATTCGGATCTCGAGATCCGAATCGCTGTTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008654.1-1883s21c1
Sequence:CCGGCTGAGAAAGTCACAGTCCATTCTCGAGAATGGACTGTGACTTTCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008654
VALIDATED
PPP1R15A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 15A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008654.1-1726s21c1
Sequence:CCGGTTCCAGGTGGCCTTCTATTTACTCGAGTAAATAGAAGGCCACCTGGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008654.1-1299s1c1
Sequence:CCGGCCATACAAGTGCCTTCCTGAACTCGAGTTCAGGAAGGCACTTGTATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008654.1-551s21c1
Sequence:CCGGCAAATGTTGATGAGTACAATGCTCGAGCATTGTACTCATCAACATTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008654.1-1737s1c1
Sequence:CCGGCTTCTATTTACCCGGAGAGAACTCGAGTTCTCTCCGGGTAAATAGAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008654.1-1805s21c1
Sequence:CCGGGGCGGCTCAGATTGTTCAAAGCTCGAGCTTTGAACAATCTGAGCCGCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008654.1-800s21c1
Sequence:CCGGCCATAGCTCCGGGATACAAACCTCGAGGTTTGTATCCCGGAGCTATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000192364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008654.1-1883s1c1
Sequence:CCGGCTGAGAAAGTCACAGTCCATTCTCGAGAATGGACTGTGACTTTCTCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008654.1-1126s1c1
Sequence:CCGGGAAGACAACAGCGATTCGGATCTCGAGATCCGAATCGCTGTTGTCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008654.1-1883s21c1
Sequence:CCGGCTGAGAAAGTCACAGTCCATTCTCGAGAATGGACTGTGACTTTCTCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???