EMAIL THIS PAGE TO A FRIEND

PPP1R15B

protein phosphatase 1, regulatory subunit 15B

199 Gene Product Result for
Synonyms: CREP
UniProtKB ID: Q5SWA1, Q53GQ4, Q658M2, Q6P156, Q96SN1
Gene ID:
Human(84919) Summary: PPP1R15B promotes dephosphorylation of the transcription initiation factor EIF2-alpha (EIF2S1; MIM 603907) through recruitment of protein phosphatase-1 (PP1) catalytic subunits (see MIM 176875) (Harding et al., 2009 [PubMed 19181853]
Mouse(108954) protein phosphatase 1, regulatory (inhibitor) subunit 15b
Rat(304799) protein phosphatase 1, regulatory subunit 15B
domestic guinea pig(100722836) protein phosphatase 1, regulatory subunit 15B
naked mole-rat(101722274) protein phosphatase 1, regulatory subunit 15B
cow(538754) protein phosphatase 1, regulatory subunit 15B
sheep(101108505) protein phosphatase 1, regulatory subunit 15B
chicken(100857158) protein phosphatase 1, regulatory subunit 15B
domestic cat(101083996) protein phosphatase 1, regulatory subunit 15B
dog(488563) protein phosphatase 1, regulatory subunit 15B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032833 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032833 Rosetta Predictions human pricing
NM_001107175 Rosetta Predictions rat pricing
NM_133819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190055 predicted 1931
2 SASI_Hs02_00360426 predicted 1657
3 SASI_Hs02_00360427 predicted 2334
4 SASI_Hs01_00190056 predicted 2053
5 SASI_Hs01_00190058 predicted 1865
6 SASI_Hs01_00190059 predicted 644
7 SASI_Hs01_00190061 predicted 1098
8 SASI_Hs01_00190062 predicted 997
9 SASI_Hs01_00190063 predicted 1555
10 SASI_Hs02_00360428 predicted 977
11 SASI_Hs01_00190054 predicted 2054
12 SASI_Hs01_00190057 predicted 859
13 SASI_Hs01_00190060 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226245 predicted 1643
2 SASI_Rn02_00226246 predicted 2300
3 SASI_Rn02_00226247 predicted 1159
4 SASI_Rn02_00226248 predicted 2028
5 SASI_Rn02_00226249 predicted 2172
6 SASI_Rn02_00226250 predicted 1635
7 SASI_Rn02_00226251 predicted 1906
8 SASI_Rn02_00226252 predicted 717
9 SASI_Rn02_00226253 predicted 666
10 SASI_Rn02_00226254 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061865 predicted 1160
2 SASI_Mm01_00061866 predicted 1155
3 SASI_Mm01_00061867 predicted 1174
4 SASI_Mm01_00061868 predicted 992
5 SASI_Mm02_00338841 predicted 752
6 SASI_Mm01_00061870 predicted 1889
7 SASI_Mm01_00061872 predicted 2032
8 SASI_Mm01_00061873 predicted 898
9 SASI_Mm01_00061874 predicted 1662
10 SASI_Mm02_00338842 predicted 893
11 SASI_Mm01_00061869 predicted 1218
12 SASI_Mm01_00061871 predicted 1274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133819
VALIDATED
PPP1R15B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 15B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182937    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133819.1-2533s1c1
Sequence:CCGGCCAACTCCGATAATGAAGAATCTCGAGATTCTTCATTATCGGAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133819.2-542s21c1
Sequence:CCGGTCCTACCAGATGGCTAGATTTCTCGAGAAATCTAGCCATCTGGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133819.2-2030s21c1
Sequence:CCGGTGGCCATCATACCTTACTTTCCTCGAGGAAAGTAAGGTATGATGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133819.2-2526s21c1
Sequence:CCGGGAAACACCAACTCCGATAATGCTCGAGCATTATCGGAGTTGGTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133819.2-2166s21c1
Sequence:CCGGGAAGAAGTTACTGAGTATTATCTCGAGATAATACTCAGTAACTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133819.2-892s21c1
Sequence:CCGGGCGTTCAGAGCTTAGGTAATTCTCGAGAATTACCTAAGCTCTGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133819
VALIDATED
PPP1R15B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 15B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182937    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133819.1-2533s1c1
Sequence:CCGGCCAACTCCGATAATGAAGAATCTCGAGATTCTTCATTATCGGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133819.2-542s21c1
Sequence:CCGGTCCTACCAGATGGCTAGATTTCTCGAGAAATCTAGCCATCTGGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133819.2-2030s21c1
Sequence:CCGGTGGCCATCATACCTTACTTTCCTCGAGGAAAGTAAGGTATGATGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133819.2-2526s21c1
Sequence:CCGGGAAACACCAACTCCGATAATGCTCGAGCATTATCGGAGTTGGTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133819.2-2166s21c1
Sequence:CCGGGAAGAAGTTACTGAGTATTATCTCGAGATAATACTCAGTAACTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133819.2-892s21c1
Sequence:CCGGGCGTTCAGAGCTTAGGTAATTCTCGAGAATTACCTAAGCTCTGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133819
VALIDATED
PPP1R15B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 15B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182937    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133819.1-2533s1c1
Sequence:CCGGCCAACTCCGATAATGAAGAATCTCGAGATTCTTCATTATCGGAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133819.2-542s21c1
Sequence:CCGGTCCTACCAGATGGCTAGATTTCTCGAGAAATCTAGCCATCTGGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133819.2-2030s21c1
Sequence:CCGGTGGCCATCATACCTTACTTTCCTCGAGGAAAGTAAGGTATGATGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133819.2-2526s21c1
Sequence:CCGGGAAACACCAACTCCGATAATGCTCGAGCATTATCGGAGTTGGTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133819.2-2166s21c1
Sequence:CCGGGAAGAAGTTACTGAGTATTATCTCGAGATAATACTCAGTAACTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133819.2-892s21c1
Sequence:CCGGGCGTTCAGAGCTTAGGTAATTCTCGAGAATTACCTAAGCTCTGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032833
VALIDATED
PPP1R15B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 15B
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032833.x-1422s1c1
Sequence:CCGGGCAGAGATAACCCAACACAGTCTCGAGACTGTGTTGGGTTATCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032833.x-2689s1c1
Sequence:CCGGGCAACATATCCCACTCAGAAACTCGAGTTTCTGAGTGGGATATGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032833.x-1025s1c1
Sequence:CCGGCCTCTAAACATTCAACGCATACTCGAGTATGCGTTGAATGTTTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032833.x-1598s1c1
Sequence:CCGGGAGGGCCGAATAAGTGTAGTTCTCGAGAACTACACTTATTCGGCCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032833.x-986s1c1
Sequence:CCGGCTGTACTCTAACCGGGAACTTCTCGAGAAGTTCCCGGTTAGAGTACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032833.3-2509s21c1
Sequence:GTACCGGACATGCTTCAAAGGACTTAATCTCGAGATTAAGTCCTTTGAAGCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032833.3-635s21c1
Sequence:CCGGTGCTTCAGAAGGTGCTAATTTCTCGAGAAATTAGCACCTTCTGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032833.3-2442s21c1
Sequence:CCGGAGAAGATGCTATTGGATATTGCTCGAGCAATATCCAATAGCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032833.3-681s21c1
Sequence:CCGGTCCGACCAGATGGCTAGATTTCTCGAGAAATCTAGCCATCTGGTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032833.3-1597s21c1
Sequence:CCGGGAGGGCCGAATAAGTGTAGTTCTCGAGAACTACACTTATTCGGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032833.3-2881s21c1
Sequence:GTACCGGCAATATTTATAGGGCTTAAAGCTCGAGCTTTAAGCCCTATAAATATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032833.3-2271s21c1
Sequence:GTACCGGGGTACAGCGTGACGTTCTTTCCTCGAGGAAAGAACGTCACGCTGTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032833.3-3033s21c1
Sequence:GTACCGGGCCTGTCTATGTTAGGCTAAACTCGAGTTTAGCCTAACATAGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_032833.3-2655s21c1
Sequence:CCGGATGTAACTTGGATCTAGTTTACTCGAGTAAACTAGATCCAAGTTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032833
VALIDATED
PPP1R15B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 15B
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032833.x-1422s1c1
Sequence:CCGGGCAGAGATAACCCAACACAGTCTCGAGACTGTGTTGGGTTATCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032833.x-2689s1c1
Sequence:CCGGGCAACATATCCCACTCAGAAACTCGAGTTTCTGAGTGGGATATGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032833.x-1025s1c1
Sequence:CCGGCCTCTAAACATTCAACGCATACTCGAGTATGCGTTGAATGTTTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032833.x-1598s1c1
Sequence:CCGGGAGGGCCGAATAAGTGTAGTTCTCGAGAACTACACTTATTCGGCCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032833.x-986s1c1
Sequence:CCGGCTGTACTCTAACCGGGAACTTCTCGAGAAGTTCCCGGTTAGAGTACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032833.3-2509s21c1
Sequence:GTACCGGACATGCTTCAAAGGACTTAATCTCGAGATTAAGTCCTTTGAAGCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032833.3-635s21c1
Sequence:CCGGTGCTTCAGAAGGTGCTAATTTCTCGAGAAATTAGCACCTTCTGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032833.3-2442s21c1
Sequence:CCGGAGAAGATGCTATTGGATATTGCTCGAGCAATATCCAATAGCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032833.3-681s21c1
Sequence:CCGGTCCGACCAGATGGCTAGATTTCTCGAGAAATCTAGCCATCTGGTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032833.3-1597s21c1
Sequence:CCGGGAGGGCCGAATAAGTGTAGTTCTCGAGAACTACACTTATTCGGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032833.3-2881s21c1
Sequence:GTACCGGCAATATTTATAGGGCTTAAAGCTCGAGCTTTAAGCCCTATAAATATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032833.3-2271s21c1
Sequence:GTACCGGGGTACAGCGTGACGTTCTTTCCTCGAGGAAAGAACGTCACGCTGTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032833.3-3033s21c1
Sequence:GTACCGGGCCTGTCTATGTTAGGCTAAACTCGAGTTTAGCCTAACATAGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_032833.3-2655s21c1
Sequence:CCGGATGTAACTTGGATCTAGTTTACTCGAGTAAACTAGATCCAAGTTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032833
VALIDATED
PPP1R15B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 15B
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032833.x-1422s1c1
Sequence:CCGGGCAGAGATAACCCAACACAGTCTCGAGACTGTGTTGGGTTATCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032833.x-2689s1c1
Sequence:CCGGGCAACATATCCCACTCAGAAACTCGAGTTTCTGAGTGGGATATGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032833.x-1025s1c1
Sequence:CCGGCCTCTAAACATTCAACGCATACTCGAGTATGCGTTGAATGTTTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032833.x-1598s1c1
Sequence:CCGGGAGGGCCGAATAAGTGTAGTTCTCGAGAACTACACTTATTCGGCCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032833.x-986s1c1
Sequence:CCGGCTGTACTCTAACCGGGAACTTCTCGAGAAGTTCCCGGTTAGAGTACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032833.3-2509s21c1
Sequence:GTACCGGACATGCTTCAAAGGACTTAATCTCGAGATTAAGTCCTTTGAAGCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032833.3-635s21c1
Sequence:CCGGTGCTTCAGAAGGTGCTAATTTCTCGAGAAATTAGCACCTTCTGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032833.3-2442s21c1
Sequence:CCGGAGAAGATGCTATTGGATATTGCTCGAGCAATATCCAATAGCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032833.3-681s21c1
Sequence:CCGGTCCGACCAGATGGCTAGATTTCTCGAGAAATCTAGCCATCTGGTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032833.3-1597s21c1
Sequence:CCGGGAGGGCCGAATAAGTGTAGTTCTCGAGAACTACACTTATTCGGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032833.3-2881s21c1
Sequence:GTACCGGCAATATTTATAGGGCTTAAAGCTCGAGCTTTAAGCCCTATAAATATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032833.3-2271s21c1
Sequence:GTACCGGGGTACAGCGTGACGTTCTTTCCTCGAGGAAAGAACGTCACGCTGTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032833.3-3033s21c1
Sequence:GTACCGGGCCTGTCTATGTTAGGCTAAACTCGAGTTTAGCCTAACATAGACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_032833.3-2655s21c1
Sequence:CCGGATGTAACTTGGATCTAGTTTACTCGAGTAAACTAGATCCAAGTTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)