EMAIL THIS PAGE TO A FRIEND

PPP1R17

protein phosphatase 1, regulatory subunit 17

156 Gene Product Result for
Synonyms: C7orf16 GSBS
UniProtKB ID: O96001, B4DE58, Q9UDQ0
Gene ID:
Human(10842) Summary: The protein encoded by this gene is found primarily in cerebellar Purkinje cells, where it functions as a protein phosphatase inhibitor. The encoded protein is a substrate for cGMP-dependent protein kinase. An allele of this gene was discovered that increases susceptibility to hypercholesterolemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(19051) protein phosphatase 1, regulatory subunit 17
Rat(266705) protein phosphatase 1, regulatory subunit 17
chicken(420753) protein phosphatase 1, regulatory subunit 17
domestic cat(101089255) protein phosphatase 1, regulatory subunit 17
dog(100685806) protein phosphatase 1, regulatory subunit 17
cow(616856) protein phosphatase 1, regulatory subunit 17
sheep(101122101) protein phosphatase 1, regulatory subunit 17
naked mole-rat(101716308) protein phosphatase 1, regulatory subunit 17
domestic guinea pig(100725648) protein phosphatase 1, regulatory subunit 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006658 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027281 MISSION® esiRNA esiRNA human C7orf16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006658 Rosetta Predictions human pricing
NM_153467 Rosetta Predictions rat pricing
NM_011153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041027 predicted 938
2 SASI_Hs01_00041028 predicted 551
3 SASI_Hs01_00041029 predicted 670
4 SASI_Hs01_00041031 predicted 701
5 SASI_Hs01_00041032 predicted 1001
6 SASI_Hs01_00041033 predicted 668
7 SASI_Hs01_00041034 predicted 705
8 SASI_Hs01_00041035 predicted 639
9 SASI_Hs01_00041036 predicted 945
10 SASI_Hs02_00342042 predicted 588
11 SASI_Hs01_00041030 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108346 predicted 642
2 SASI_Rn01_00108347 predicted 751
3 SASI_Rn01_00108348 predicted 365
4 SASI_Rn01_00108349 predicted 524
5 SASI_Rn01_00108350 predicted 341
6 SASI_Rn01_00108352 predicted 370
7 SASI_Rn01_00108353 predicted 356
8 SASI_Rn01_00108354 predicted 819
9 SASI_Rn01_00108355 predicted 624
10 SASI_Rn02_00268978 predicted 580
11 SASI_Rn01_00108351 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201497 predicted 366
2 SASI_Mm01_00201498 predicted 423
3 SASI_Mm01_00201499 predicted 941
4 SASI_Mm01_00201500 predicted 511
5 SASI_Mm01_00201501 predicted 584
6 SASI_Mm01_00201502 predicted 934
7 SASI_Mm01_00201503 predicted 1034
8 SASI_Mm01_00201504 predicted 353
9 SASI_Mm01_00201505 predicted 1020
10 SASI_Mm01_00201506 predicted 1025
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011153
PPP1R17 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011153.2-443s1c1
Sequence:CCGGCAGCTCTTCATAACTCTGATACTCGAGTATCAGAGTTATGAAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011153.2-553s1c1
Sequence:CCGGGCAGGAGTGATTCTAGAGGATCTCGAGATCCTCTAGAATCACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011153.2-401s1c1
Sequence:CCGGGATATGATGTTCAAGAGAGAACTCGAGTTCTCTCTTGAACATCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011153.2-1177s1c1
Sequence:CCGGCCAGCCCATTATGCAAGAATACTCGAGTATTCTTGCATAATGGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011153.2-295s1c1
Sequence:CCGGACTCTGAATGTTGAGTCAGATCTCGAGATCTGACTCAACATTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011153
PPP1R17 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011153.2-443s1c1
Sequence:CCGGCAGCTCTTCATAACTCTGATACTCGAGTATCAGAGTTATGAAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011153.2-553s1c1
Sequence:CCGGGCAGGAGTGATTCTAGAGGATCTCGAGATCCTCTAGAATCACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011153.2-401s1c1
Sequence:CCGGGATATGATGTTCAAGAGAGAACTCGAGTTCTCTCTTGAACATCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011153.2-1177s1c1
Sequence:CCGGCCAGCCCATTATGCAAGAATACTCGAGTATTCTTGCATAATGGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011153.2-295s1c1
Sequence:CCGGACTCTGAATGTTGAGTCAGATCTCGAGATCTGACTCAACATTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011153
PPP1R17 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011153.2-443s1c1
Sequence:CCGGCAGCTCTTCATAACTCTGATACTCGAGTATCAGAGTTATGAAGAGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011153.2-553s1c1
Sequence:CCGGGCAGGAGTGATTCTAGAGGATCTCGAGATCCTCTAGAATCACTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011153.2-401s1c1
Sequence:CCGGGATATGATGTTCAAGAGAGAACTCGAGTTCTCTCTTGAACATCATATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011153.2-1177s1c1
Sequence:CCGGCCAGCCCATTATGCAAGAATACTCGAGTATTCTTGCATAATGGGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011153.2-295s1c1
Sequence:CCGGACTCTGAATGTTGAGTCAGATCTCGAGATCTGACTCAACATTCAGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006658
PPP1R17 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 17
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006658.x-173s1c1
Sequence:CCGGCCCTCGTTGCAGCCACTTAGACTCGAGTCTAAGTGGCTGCAACGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006658.x-212s1c1
Sequence:CCGGCATTAAGGACTGTGATCTCAACTCGAGTTGAGATCACAGTCCTTAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006658.3-605s21c1
Sequence:CCGGTGGTGACAAGATAGCTATTTACTCGAGTAAATAGCTATCTTGTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006658.x-387s1c1
Sequence:CCGGGAGAGACATCCAAAGGGCAAACTCGAGTTTGCCCTTTGGATGTCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006658.x-180s1c1
Sequence:CCGGTGCAGCCACTTAGATGATCTTCTCGAGAAGATCATCTAAGTGGCTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006658.x-944s1c1
Sequence:CCGGGCAGGACTTGACTTAGCATTACTCGAGTAATGCTAAGTCAAGTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006658.3-941s21c1
Sequence:CCGGCGGAACAGAGATCGTGGATTACTCGAGTAATCCACGATCTCTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006658.3-1111s21c1
Sequence:CCGGATTTCTCCTGTCCTATCTTAACTCGAGTTAAGATAGGACAGGAGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006658.3-244s21c1
Sequence:CCGGATCTTTCAGACCAGTTCATTACTCGAGTAATGAACTGGTCTGAAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006658
PPP1R17 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 17
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006658.x-173s1c1
Sequence:CCGGCCCTCGTTGCAGCCACTTAGACTCGAGTCTAAGTGGCTGCAACGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006658.x-212s1c1
Sequence:CCGGCATTAAGGACTGTGATCTCAACTCGAGTTGAGATCACAGTCCTTAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006658.3-605s21c1
Sequence:CCGGTGGTGACAAGATAGCTATTTACTCGAGTAAATAGCTATCTTGTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006658.x-387s1c1
Sequence:CCGGGAGAGACATCCAAAGGGCAAACTCGAGTTTGCCCTTTGGATGTCTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006658.x-180s1c1
Sequence:CCGGTGCAGCCACTTAGATGATCTTCTCGAGAAGATCATCTAAGTGGCTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006658.x-944s1c1
Sequence:CCGGGCAGGACTTGACTTAGCATTACTCGAGTAATGCTAAGTCAAGTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006658.3-941s21c1
Sequence:CCGGCGGAACAGAGATCGTGGATTACTCGAGTAATCCACGATCTCTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006658.3-1111s21c1
Sequence:CCGGATTTCTCCTGTCCTATCTTAACTCGAGTTAAGATAGGACAGGAGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006658.3-244s21c1
Sequence:CCGGATCTTTCAGACCAGTTCATTACTCGAGTAATGAACTGGTCTGAAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006658
PPP1R17 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 17
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006658.x-173s1c1
Sequence:CCGGCCCTCGTTGCAGCCACTTAGACTCGAGTCTAAGTGGCTGCAACGAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006658.x-212s1c1
Sequence:CCGGCATTAAGGACTGTGATCTCAACTCGAGTTGAGATCACAGTCCTTAATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006658.3-605s21c1
Sequence:CCGGTGGTGACAAGATAGCTATTTACTCGAGTAAATAGCTATCTTGTCACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006658.x-387s1c1
Sequence:CCGGGAGAGACATCCAAAGGGCAAACTCGAGTTTGCCCTTTGGATGTCTCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006658.x-180s1c1
Sequence:CCGGTGCAGCCACTTAGATGATCTTCTCGAGAAGATCATCTAAGTGGCTGCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006658.x-944s1c1
Sequence:CCGGGCAGGACTTGACTTAGCATTACTCGAGTAATGCTAAGTCAAGTCCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006658.3-941s21c1
Sequence:CCGGCGGAACAGAGATCGTGGATTACTCGAGTAATCCACGATCTCTGTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006658.3-1111s21c1
Sequence:CCGGATTTCTCCTGTCCTATCTTAACTCGAGTTAAGATAGGACAGGAGAAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006658.3-244s21c1
Sequence:CCGGATCTTTCAGACCAGTTCATTACTCGAGTAATGAACTGGTCTGAAAGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)