EMAIL THIS PAGE TO A FRIEND

PPP1R18

protein phosphatase 1, regulatory subunit 18

96 Gene Product Result for
Synonyms: HKMT1098 KIAA1949
Gene ID:
Human(170954) Summary: Protein phosphatase-1 (PP1; see MIM 176875) interacts with regulatory subunits that target the enzyme to different cellular locations and change its activity toward specific substrates. Phostensin is a regulatory subunit that targets PP1 to F-actin (see MIM 102610) cytoskeleton (Kao et al., 2007 [PubMed 17374523]
Mouse(76448) protein phosphatase 1, regulatory subunit 18
Rat(361790) protein phosphatase 1, regulatory subunit 18
domestic guinea pig(100718987) protein phosphatase 1, regulatory subunit 18
naked mole-rat(101704083) protein phosphatase 1, regulatory subunit 18
cow(539829) protein phosphatase 1, regulatory subunit 18
sheep(101109918) protein phosphatase 1, regulatory subunit 18
Zebrafish(570052) protein phosphatase 1, regulatory subunit 18
domestic cat(101094595) protein phosphatase 1, regulatory subunit 18
dog(100687245) protein phosphatase 1, regulatory subunit 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001146711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001146711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001134870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001134870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001134870 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133471 Rosetta Predictions human pricing
XM_929867 Rosetta Predictions human pricing
XM_934035 Rosetta Predictions human pricing
XM_934039 Rosetta Predictions human pricing
NM_001126287 Rosetta Predictions rat pricing
XM_001003622 Rosetta Predictions mouse pricing
XM_001474189 Rosetta Predictions mouse pricing
XM_902015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363168 predicted 740
2 SASI_Hs02_00363169 predicted 1789
3 SASI_Hs02_00363170 predicted 1001
4 SASI_Hs02_00363171 predicted 2389
5 SASI_Hs02_00363172 predicted 720
6 SASI_Hs02_00363173 predicted 2133
7 SASI_Hs02_00363174 predicted 888
8 SASI_Hs02_00363175 predicted 2252
9 SASI_Hs02_00363176 predicted 2185
10 SASI_Hs02_00363177 predicted 2387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287246 predicted 680
2 SASI_Hs01_00287247 predicted 1738
3 SASI_Hs01_00287248 predicted 940
4 SASI_Hs01_00287249 predicted 2332
5 SASI_Hs01_00287250 predicted 667
6 SASI_Hs01_00287251 predicted 2073
7 SASI_Hs01_00287252 predicted 825
8 SASI_Hs01_00287253 predicted 2193
9 SASI_Hs01_00287254 predicted 2124
10 SASI_Hs01_00287255 predicted 1762
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258229 predicted 2267
2 SASI_Hs01_00258230 predicted 1474
3 SASI_Hs01_00258231 predicted 1369
4 SASI_Hs01_00258232 predicted 1373
5 SASI_Hs01_00258233 predicted 2297
6 SASI_Hs01_00258234 predicted 1701
7 SASI_Hs01_00258235 predicted 1466
8 SASI_Hs01_00258236 predicted 2464
9 SASI_Hs01_00258237 predicted 1420
10 SASI_Hs01_00258238 predicted 1415
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263851 predicted 3475
2 SASI_Hs01_00263852 predicted 2686
3 SASI_Hs01_00263853 predicted 4078
4 SASI_Hs01_00263854 predicted 3820
5 SASI_Hs01_00263855 predicted 2573
6 SASI_Hs01_00263856 predicted 3940
7 SASI_Hs01_00263857 predicted 3876
8 SASI_Hs01_00263858 predicted 4075
9 SASI_Hs01_00263859 predicted 3512
10 SASI_Hs01_00263860 predicted 2917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253243 predicted 820
2 SASI_Rn02_00253244 predicted 1858
3 SASI_Rn02_00253245 predicted 1859
4 SASI_Rn02_00253246 predicted 1862
5 SASI_Rn02_00253247 predicted 820
6 SASI_Rn02_00253248 predicted 1897
7 SASI_Rn02_00253249 predicted 1873
8 SASI_Rn02_00253250 predicted 733
9 SASI_Rn02_00253251 predicted 1656
10 SASI_Rn02_00253252 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205542 predicted 701
2 SASI_Mm02_00355912 predicted 708
3 SASI_Mm02_00355913 predicted 700
4 SASI_Mm02_00355914 predicted 706
5 SASI_Mm02_00355915 predicted 694
6 SASI_Mm02_00355916 predicted 542
7 SASI_Mm01_00205543 predicted 934
8 SASI_Mm02_00355917 predicted 461
9 SASI_Mm02_00355918 predicted 343
10 SASI_Mm02_00355919 predicted 1372
11 SASI_Mm01_00205544 predicted 1087
12 SASI_Mm01_00205545 predicted 1019
13 SASI_Mm01_00205546 predicted 991
14 SASI_Mm01_00205547 predicted 953
15 SASI_Mm01_00205548 predicted 781
16 SASI_Mm01_00205549 predicted 1006
17 SASI_Mm01_00205550 predicted 1122
18 SASI_Mm01_00205551 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00373605 predicted 708
2 SASI_Mm02_00373606 predicted 944
3 SASI_Mm02_00373607 predicted 968
4 SASI_Mm02_00373608 predicted 804
5 SASI_Mm02_00373609 predicted 946
6 SASI_Mm02_00373610 predicted 743
7 SASI_Mm02_00373611 predicted 736
8 SASI_Mm02_00373612 predicted 956
9 SASI_Mm02_00373613 predicted 959
10 SASI_Mm02_00373614 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224583 predicted 1250
2 SASI_Mm01_00224584 predicted 1481
3 SASI_Mm01_00224585 predicted 1577
4 SASI_Mm01_00224586 predicted 1509
5 SASI_Mm01_00224587 predicted 1446
6 SASI_Mm01_00224588 predicted 1281
7 SASI_Mm01_00224589 predicted 1267
8 SASI_Mm01_00224590 predicted 708
9 SASI_Mm01_00224591 predicted 1615
10 SASI_Mm01_00224592 predicted 1561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146711
VALIDATED
PPP1R18 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001146711.1-1080s21c1
Sequence:CCGGGACGACCTGGGACATAGATACCTCGAGGTATCTATGTCCCAGGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146711.1-474s21c1
Sequence:CCGGGAGATCAAGTCCTGGTAATTTCTCGAGAAATTACCAGGACTTGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146711.1-1039s21c1
Sequence:CCGGAGCTGGAAATGGACCCTAAACCTCGAGGTTTAGGGTCCATTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001146711.1-2053s21c1
Sequence:CCGGGCAGAGCCAGTAGCCTAAATTCTCGAGAATTTAGGCTACTGGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146711.1-806s21c1
Sequence:CCGGGCCCGACAGATGTCCATAAATCTCGAGATTTATGGACATCTGTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146711
VALIDATED
PPP1R18 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001146711.1-1080s21c1
Sequence:CCGGGACGACCTGGGACATAGATACCTCGAGGTATCTATGTCCCAGGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146711.1-474s21c1
Sequence:CCGGGAGATCAAGTCCTGGTAATTTCTCGAGAAATTACCAGGACTTGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146711.1-1039s21c1
Sequence:CCGGAGCTGGAAATGGACCCTAAACCTCGAGGTTTAGGGTCCATTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001146711.1-2053s21c1
Sequence:CCGGGCAGAGCCAGTAGCCTAAATTCTCGAGAATTTAGGCTACTGGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146711.1-806s21c1
Sequence:CCGGGCCCGACAGATGTCCATAAATCTCGAGATTTATGGACATCTGTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146711
VALIDATED
PPP1R18 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001146711.1-1080s21c1
Sequence:CCGGGACGACCTGGGACATAGATACCTCGAGGTATCTATGTCCCAGGTCGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000341937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146711.1-474s21c1
Sequence:CCGGGAGATCAAGTCCTGGTAATTTCTCGAGAAATTACCAGGACTTGATCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000341938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146711.1-1039s21c1
Sequence:CCGGAGCTGGAAATGGACCCTAAACCTCGAGGTTTAGGGTCCATTTCCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000341940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001146711.1-2053s21c1
Sequence:CCGGGCAGAGCCAGTAGCCTAAATTCTCGAGAATTTAGGCTACTGGCTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000341939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146711.1-806s21c1
Sequence:CCGGGCCCGACAGATGTCCATAAATCTCGAGATTTATGGACATCTGTCGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134870
VALIDATED
PPP1R18 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-1828s21c1
Sequence:CCGGAGACACCACAAACAGCTTAAGCTCGAGCTTAAGCTGTTTGTGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-2069s21c1
Sequence:CCGGGGTGACCATCTTCCAACATAGCTCGAGCTATGTTGGAAGATGGTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-1211s21c1
Sequence:CCGGAGCCAACAGAAGGGTGGAAATCTCGAGATTTCCACCCTTCTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-932s21c1
Sequence:CCGGGCCTGACAGAGGCCCATAAATCTCGAGATTTATGGGCCTCTGTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-2095s21c1
Sequence:CCGGTACCTCCCTCCTTCTTATAACCTCGAGGTTATAAGAAGGAGGGAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134870
VALIDATED
PPP1R18 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-1828s21c1
Sequence:CCGGAGACACCACAAACAGCTTAAGCTCGAGCTTAAGCTGTTTGTGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-2069s21c1
Sequence:CCGGGGTGACCATCTTCCAACATAGCTCGAGCTATGTTGGAAGATGGTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-1211s21c1
Sequence:CCGGAGCCAACAGAAGGGTGGAAATCTCGAGATTTCCACCCTTCTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-932s21c1
Sequence:CCGGGCCTGACAGAGGCCCATAAATCTCGAGATTTATGGGCCTCTGTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-2095s21c1
Sequence:CCGGTACCTCCCTCCTTCTTATAACCTCGAGGTTATAAGAAGGAGGGAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134870
VALIDATED
PPP1R18 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-1828s21c1
Sequence:CCGGAGACACCACAAACAGCTTAAGCTCGAGCTTAAGCTGTTTGTGGTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000282572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-2069s21c1
Sequence:CCGGGGTGACCATCTTCCAACATAGCTCGAGCTATGTTGGAAGATGGTCACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000263314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-1211s21c1
Sequence:CCGGAGCCAACAGAAGGGTGGAAATCTCGAGATTTCCACCCTTCTGTTGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000263316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-932s21c1
Sequence:CCGGGCCTGACAGAGGCCCATAAATCTCGAGATTTATGGGCCTCTGTCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000263315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001134870.1-2095s21c1
Sequence:CCGGTACCTCCCTCCTTCTTATAACCTCGAGGTTATAAGAAGGAGGGAGGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???