EMAIL THIS PAGE TO A FRIEND

PPP1R1A

protein phosphatase 1, regulatory (inhibitor) subunit 1A

80 Gene Product Result for
Synonyms: I1 IPP1
UniProtKB ID: Q13522, Q6IB01, Q8TBJ2, Q8WWV2
Gene ID:
Mouse(58200) protein phosphatase 1, regulatory (inhibitor) subunit 1A
Rat(58977) protein phosphatase 1, regulatory (inhibitor) subunit 1A
dog(403605) protein phosphatase 1, regulatory (inhibitor) subunit 1A
domestic cat(101101484) protein phosphatase 1, regulatory (inhibitor) subunit 1A
cow(767949) protein phosphatase 1, regulatory (inhibitor) subunit 1A
sheep(101107087) protein phosphatase 1, regulatory (inhibitor) subunit 1A
naked mole-rat(101717329) protein phosphatase 1, regulatory (inhibitor) subunit 1A
domestic guinea pig(100722655) protein phosphatase 1, regulatory (inhibitor) subunit 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006741 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006741 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006741 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006741 Rosetta Predictions human pricing
NM_022676 Rosetta Predictions rat pricing
NM_021391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092307 predicted 948
2 SASI_Hs01_00092308 predicted 946
3 SASI_Hs01_00092310 predicted 796
4 SASI_Hs02_00342189 predicted 606
5 SASI_Hs01_00092309 predicted 937
6 SASI_Hs01_00092314 predicted 397
7 SASI_Hs01_00092315 predicted 666
8 SASI_Hs01_00092316 predicted 639
9 SASI_Hs02_00342190 predicted 339
10 SASI_Hs02_00342191 predicted 829
11 SASI_Hs01_00092311 predicted 993
12 SASI_Hs01_00092312 predicted 978
13 SASI_Hs01_00092313 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037275 predicted 889
2 SASI_Rn01_00037276 predicted 912
3 SASI_Rn02_00263457 predicted 689
4 SASI_Rn01_00037277 predicted 828
5 SASI_Rn01_00037278 predicted 1035
6 SASI_Rn01_00037279 predicted 1111
7 SASI_Rn01_00037280 predicted 952
8 SASI_Rn01_00037281 predicted 485
9 SASI_Rn01_00037282 predicted 351
10 SASI_Rn02_00263458 predicted 862
11 SASI_Rn01_00037283 predicted 734
12 SASI_Rn01_00037284 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060026 predicted 682
2 SASI_Mm02_00325988 predicted 217
3 SASI_Mm01_00060028 predicted 1046
4 SASI_Mm01_00060029 predicted 659
5 SASI_Mm01_00060030 predicted 1064
6 SASI_Mm01_00060031 predicted 281
7 SASI_Mm02_00325989 predicted 971
8 SASI_Mm02_00325990 predicted 809
9 SASI_Mm02_00325991 predicted 947
10 SASI_Mm02_00325992 predicted 800
11 SASI_Mm01_00060027 predicted 641
12 SASI_Mm01_00060032 predicted 978
13 SASI_Mm01_00060033 predicted 797
14 SASI_Mm01_00060034 predicted 692
15 SASI_Mm01_00060035 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006741
VALIDATED
PPP1R1A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 1A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006741.3-727s21c1
Sequence:CCGGGAATGCATGGACACCGGATTTCTCGAGAAATCCGGTGTCCATGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-645s21c1
Sequence:CCGGCCATATACCACCACTGGATTCCTCGAGGAATCCAGTGGTGGTATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-369s21c1
Sequence:CCGGGTCTCCACGGCAACGGAAGAACTCGAGTTCTTCCGTTGCCGTGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-527s21c1
Sequence:CCGGCAGACACAGAAGTGGAGTCAACTCGAGTTGACTCCACTTCTGTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-577s21c1
Sequence:CCGGACTGCAGAATGCATCCCTAAACTCGAGTTTAGGGATGCATTCTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006741.3-1374s21c1
Sequence:CCGGAGAGAACACAGTGGCTATTAACTCGAGTTAATAGCCACTGTGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-398s21c1
Sequence:CCGGGGATCACACCCACAATGAAAGCTCGAGCTTTCATTGTGGGTGTGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-343s21c1
Sequence:CCGGCCACATCTCAAGTCCACTTTGCTCGAGCAAAGTGGACTTGAGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006741.x-1341s1c1
Sequence:CCGGGTCCCTTATTTCAACCCGTTACTCGAGTAACGGGTTGAAATAAGGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006741.x-407s1c1
Sequence:CCGGCCACAATGAAAGAGCTCCAGACTCGAGTCTGGAGCTCTTTCATTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006741.x-612s1c1
Sequence:CCGGCAGTAAGGAACCCAGCACAAACTCGAGTTTGTGCTGGGTTCCTTACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006741.x-315s1c1
Sequence:CCGGAGAGATAGATGAAGACCGGATCTCGAGATCCGGTCTTCATCTATCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006741.x-341s1c1
Sequence:CCGGACCCACATCTCAAGTCCACTTCTCGAGAAGTGGACTTGAGATGTGGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006741
VALIDATED
PPP1R1A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 1A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006741.3-727s21c1
Sequence:CCGGGAATGCATGGACACCGGATTTCTCGAGAAATCCGGTGTCCATGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-645s21c1
Sequence:CCGGCCATATACCACCACTGGATTCCTCGAGGAATCCAGTGGTGGTATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-369s21c1
Sequence:CCGGGTCTCCACGGCAACGGAAGAACTCGAGTTCTTCCGTTGCCGTGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-527s21c1
Sequence:CCGGCAGACACAGAAGTGGAGTCAACTCGAGTTGACTCCACTTCTGTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-577s21c1
Sequence:CCGGACTGCAGAATGCATCCCTAAACTCGAGTTTAGGGATGCATTCTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006741.3-1374s21c1
Sequence:CCGGAGAGAACACAGTGGCTATTAACTCGAGTTAATAGCCACTGTGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-398s21c1
Sequence:CCGGGGATCACACCCACAATGAAAGCTCGAGCTTTCATTGTGGGTGTGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-343s21c1
Sequence:CCGGCCACATCTCAAGTCCACTTTGCTCGAGCAAAGTGGACTTGAGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006741.x-1341s1c1
Sequence:CCGGGTCCCTTATTTCAACCCGTTACTCGAGTAACGGGTTGAAATAAGGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006741.x-407s1c1
Sequence:CCGGCCACAATGAAAGAGCTCCAGACTCGAGTCTGGAGCTCTTTCATTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006741.x-612s1c1
Sequence:CCGGCAGTAAGGAACCCAGCACAAACTCGAGTTTGTGCTGGGTTCCTTACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006741.x-315s1c1
Sequence:CCGGAGAGATAGATGAAGACCGGATCTCGAGATCCGGTCTTCATCTATCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006741.x-341s1c1
Sequence:CCGGACCCACATCTCAAGTCCACTTCTCGAGAAGTGGACTTGAGATGTGGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006741
VALIDATED
PPP1R1A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 1A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006741.3-727s21c1
Sequence:CCGGGAATGCATGGACACCGGATTTCTCGAGAAATCCGGTGTCCATGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-645s21c1
Sequence:CCGGCCATATACCACCACTGGATTCCTCGAGGAATCCAGTGGTGGTATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-369s21c1
Sequence:CCGGGTCTCCACGGCAACGGAAGAACTCGAGTTCTTCCGTTGCCGTGGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-527s21c1
Sequence:CCGGCAGACACAGAAGTGGAGTCAACTCGAGTTGACTCCACTTCTGTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-577s21c1
Sequence:CCGGACTGCAGAATGCATCCCTAAACTCGAGTTTAGGGATGCATTCTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006741.3-1374s21c1
Sequence:CCGGAGAGAACACAGTGGCTATTAACTCGAGTTAATAGCCACTGTGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-398s21c1
Sequence:CCGGGGATCACACCCACAATGAAAGCTCGAGCTTTCATTGTGGGTGTGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006741.3-343s21c1
Sequence:CCGGCCACATCTCAAGTCCACTTTGCTCGAGCAAAGTGGACTTGAGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006741.x-1341s1c1
Sequence:CCGGGTCCCTTATTTCAACCCGTTACTCGAGTAACGGGTTGAAATAAGGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006741.x-407s1c1
Sequence:CCGGCCACAATGAAAGAGCTCCAGACTCGAGTCTGGAGCTCTTTCATTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006741.x-612s1c1
Sequence:CCGGCAGTAAGGAACCCAGCACAAACTCGAGTTTGTGCTGGGTTCCTTACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006741.x-315s1c1
Sequence:CCGGAGAGATAGATGAAGACCGGATCTCGAGATCCGGTCTTCATCTATCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006741.x-341s1c1
Sequence:CCGGACCCACATCTCAAGTCCACTTCTCGAGAAGTGGACTTGAGATGTGGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021391
PPP1R1A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 1A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021391.2-1054s1c1
Sequence:CCGGCCTTGTACAAACCTGACACAACTCGAGTTGTGTCAGGTTTGTACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021391.2-339s1c1
Sequence:CCGGACGATGGTTGAACATCACCTACTCGAGTAGGTGATGTTCAACCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021391.2-448s1c1
Sequence:CCGGGCTCGGCGTCAAGGCCAGATACTCGAGTATCTGGCCTTGACGCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021391.2-534s1c1
Sequence:CCGGCCCAGAACAGAGGATTCTTCACTCGAGTGAAGAATCCTCTGTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021391.2-254s1c1
Sequence:CCGGCTCACTTCTCAAGTCCACCTTCTCGAGAAGGTGGACTTGAGAAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021391
PPP1R1A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 1A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021391.2-1054s1c1
Sequence:CCGGCCTTGTACAAACCTGACACAACTCGAGTTGTGTCAGGTTTGTACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021391.2-339s1c1
Sequence:CCGGACGATGGTTGAACATCACCTACTCGAGTAGGTGATGTTCAACCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021391.2-448s1c1
Sequence:CCGGGCTCGGCGTCAAGGCCAGATACTCGAGTATCTGGCCTTGACGCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021391.2-534s1c1
Sequence:CCGGCCCAGAACAGAGGATTCTTCACTCGAGTGAAGAATCCTCTGTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021391.2-254s1c1
Sequence:CCGGCTCACTTCTCAAGTCCACCTTCTCGAGAAGGTGGACTTGAGAAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021391
PPP1R1A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 1A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021391.2-1054s1c1
Sequence:CCGGCCTTGTACAAACCTGACACAACTCGAGTTGTGTCAGGTTTGTACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021391.2-339s1c1
Sequence:CCGGACGATGGTTGAACATCACCTACTCGAGTAGGTGATGTTCAACCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021391.2-448s1c1
Sequence:CCGGGCTCGGCGTCAAGGCCAGATACTCGAGTATCTGGCCTTGACGCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021391.2-534s1c1
Sequence:CCGGCCCAGAACAGAGGATTCTTCACTCGAGTGAAGAATCCTCTGTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021391.2-254s1c1
Sequence:CCGGCTCACTTCTCAAGTCCACCTTCTCGAGAAGGTGGACTTGAGAAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)