EMAIL THIS PAGE TO A FRIEND

PPP1R1C

protein phosphatase 1, regulatory (inhibitor) subunit 1C

209 Gene Product Result for
Synonyms: IPP5
UniProtKB ID: Q8WVI7, Q5HYJ5, Q8TD54
Gene ID:
Human(151242) Summary: Protein phosphatase-1 (PP1) is a major serine/threonine phosphatase that regulates a variety of cellular functions. PP1 consists of a catalytic subunit (see PPP1CA; MIM 176875) and regulatory subunits that determine the subcellular localization of PP1 or regulate its function. PPP1R1C belongs to a group of PP1 inhibitory subunits that are themselves regulated by phosphorylation (Wang et al., 2008 [PubMed 18310074]
Mouse(75276) protein phosphatase 1, regulatory (inhibitor) subunit 1C
Rat(499818) protein phosphatase 1, regulatory (inhibitor) subunit 1C
cow(784202) protein phosphatase 1, regulatory (inhibitor) subunit 1C
sheep(101119792) protein phosphatase 1, regulatory (inhibitor) subunit 1C
naked mole-rat(101711523) protein phosphatase 1, regulatory (inhibitor) subunit 1C
domestic guinea pig(100729413) protein phosphatase 1, regulatory (inhibitor) subunit 1C
Zebrafish(436811) protein phosphatase 1, regulatory (inhibitor) subunit 1C
domestic cat(101082680) protein phosphatase 1, regulatory (inhibitor) subunit 1C
dog(100683308) protein phosphatase 1, regulatory (inhibitor) subunit 1C
chicken(424117) protein phosphatase 1, regulatory (inhibitor) subunit 1C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080545 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_087137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_087137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_087137 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152621 MISSION® esiRNA esiRNA human PPP1R1C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080545 Rosetta Predictions human pricing
XM_087137 Rosetta Predictions human pricing
XM_929092 Rosetta Predictions human pricing
XM_933420 Rosetta Predictions human pricing
XM_933436 Rosetta Predictions human pricing
XM_933439 Rosetta Predictions human pricing
NM_001109200 Rosetta Predictions rat pricing
NM_172420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315860 predicted 675
2 SASI_Hs02_00315861 predicted 764
3 SASI_Hs02_00315862 predicted 743
4 SASI_Hs02_00315863 predicted 764
5 SASI_Hs02_00315864 predicted 638
6 SASI_Hs02_00315865 predicted 485
7 SASI_Hs02_00315866 predicted 789
8 SASI_Hs02_00315867 predicted 542
9 SASI_Hs02_00315868 predicted 733
10 SASI_Hs02_00315869 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_087137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257475 predicted 726
2 SASI_Hs01_00257476 predicted 962
3 SASI_Hs01_00257477 predicted 759
4 SASI_Hs01_00257478 predicted 759
5 SASI_Hs01_00257479 predicted 392
6 SASI_Hs01_00257480 predicted 606
7 SASI_Hs01_00257481 predicted 728
8 SASI_Hs01_00257482 predicted 485
9 SASI_Hs01_00257483 predicted 543
10 SASI_Hs01_00257484 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264072 predicted 751
2 SASI_Hs01_00264073 predicted 981
3 SASI_Hs01_00264074 predicted 772
4 SASI_Hs01_00264075 predicted 774
5 SASI_Hs01_00264076 predicted 412
6 SASI_Hs01_00264077 predicted 625
7 SASI_Hs01_00264078 predicted 749
8 SASI_Hs01_00264079 predicted 510
9 SASI_Hs01_00264080 predicted 562
10 SASI_Hs01_00264081 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273769 predicted 674
2 SASI_Hs01_00273770 predicted 763
3 SASI_Hs01_00273771 predicted 763
4 SASI_Hs01_00273772 predicted 389
5 SASI_Hs01_00273773 predicted 645
6 SASI_Hs01_00273774 predicted 486
7 SASI_Hs01_00273775 predicted 793
8 SASI_Hs01_00273776 predicted 548
9 SASI_Hs01_00273777 predicted 735
10 SASI_Hs01_00273778 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274455 predicted 767
2 SASI_Hs01_00274456 predicted 683
3 SASI_Hs01_00274457 predicted 743
4 SASI_Hs01_00274458 predicted 386
5 SASI_Hs01_00274459 predicted 635
6 SASI_Hs01_00274460 predicted 549
7 SASI_Hs01_00274461 predicted 726
8 SASI_Hs01_00274462 predicted 1078
9 SASI_Hs01_00274463 predicted 730
10 SASI_Hs01_00274464 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269569 predicted 419
2 SASI_Hs01_00269570 predicted 413
3 SASI_Hs01_00269571 predicted 375
4 SASI_Hs01_00269572 predicted 302
5 SASI_Hs01_00269573 predicted 406
6 SASI_Hs01_00269574 predicted 306
7 SASI_Hs01_00269575 predicted 311
8 SASI_Hs01_00269576 predicted 320
9 SASI_Hs01_00269577 predicted 325
10 SASI_Hs01_00269578 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246080 predicted 413
2 SASI_Rn02_00246081 predicted 998
3 SASI_Rn02_00246082 predicted 960
4 SASI_Rn02_00246083 predicted 929
5 SASI_Rn02_00246084 predicted 1048
6 SASI_Rn02_00246085 predicted 983
7 SASI_Rn02_00246086 predicted 610
8 SASI_Rn02_00246087 predicted 1193
9 SASI_Rn02_00246088 predicted 918
10 SASI_Rn02_00246089 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020156 predicted 963
2 SASI_Mm01_00020157 predicted 1208
3 SASI_Mm01_00020158 predicted 1043
4 SASI_Mm01_00020159 predicted 965
5 SASI_Mm01_00020160 predicted 545
6 SASI_Mm01_00020163 predicted 1029
7 SASI_Mm01_00020164 predicted 899
8 SASI_Mm01_00020165 predicted 632
9 SASI_Mm02_00343893 predicted 1085
10 SASI_Mm02_00343894 predicted 1138
11 SASI_Mm01_00020161 predicted 582
12 SASI_Mm01_00020162 predicted 512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080545
PPP1R1C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 1C
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000359807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080545.1-328s21c1
Sequence:CCGGCTGTATTCCAGAGTCAGATTGCTCGAGCAATCTGACTCTGGAATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080545.1-797s21c1
Sequence:CCGGATTGTTCCACATCACTTATAACTCGAGTTATAAGTGATGTGGAACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080545.1-598s21c1
Sequence:CCGGAGGAGCAGCGGGACCATTAATCTCGAGATTAATGGTCCCGCTGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080545.1-646s21c1
Sequence:CCGGGGAAATAACTGAACTATTAACCTCGAGGTTAATAGTTCAGTTATTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080545
PPP1R1C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 1C
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000359807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080545.1-328s21c1
Sequence:CCGGCTGTATTCCAGAGTCAGATTGCTCGAGCAATCTGACTCTGGAATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080545.1-797s21c1
Sequence:CCGGATTGTTCCACATCACTTATAACTCGAGTTATAAGTGATGTGGAACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080545.1-598s21c1
Sequence:CCGGAGGAGCAGCGGGACCATTAATCTCGAGATTAATGGTCCCGCTGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080545.1-646s21c1
Sequence:CCGGGGAAATAACTGAACTATTAACCTCGAGGTTAATAGTTCAGTTATTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080545
PPP1R1C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 1C
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000359807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080545.1-328s21c1
Sequence:CCGGCTGTATTCCAGAGTCAGATTGCTCGAGCAATCTGACTCTGGAATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080545.1-797s21c1
Sequence:CCGGATTGTTCCACATCACTTATAACTCGAGTTATAAGTGATGTGGAACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080545.1-598s21c1
Sequence:CCGGAGGAGCAGCGGGACCATTAATCTCGAGATTAATGGTCCCGCTGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080545.1-646s21c1
Sequence:CCGGGGAAATAACTGAACTATTAACCTCGAGGTTAATAGTTCAGTTATTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172420
PPP1R1C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 1C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172420.2-1448s1c1
Sequence:CCGGGCCATCTATATTGTATCACTTCTCGAGAAGTGATACAATATAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172420.2-435s1c1
Sequence:CCGGCCTTTATTCCAGAGTCAGATTCTCGAGAATCTGACTCTGGAATAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172420.2-501s1c1
Sequence:CCGGGCATCCCTTGTGATTCTCAATCTCGAGATTGAGAATCACAAGGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172420.2-504s1c1
Sequence:CCGGTCCCTTGTGATTCTCAATGAACTCGAGTTCATTGAGAATCACAAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172420.2-624s1c1
Sequence:CCGGGCCATGAAAGGCGTTAAGCATCTCGAGATGCTTAACGCCTTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172420
PPP1R1C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 1C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172420.2-1448s1c1
Sequence:CCGGGCCATCTATATTGTATCACTTCTCGAGAAGTGATACAATATAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172420.2-435s1c1
Sequence:CCGGCCTTTATTCCAGAGTCAGATTCTCGAGAATCTGACTCTGGAATAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172420.2-501s1c1
Sequence:CCGGGCATCCCTTGTGATTCTCAATCTCGAGATTGAGAATCACAAGGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172420.2-504s1c1
Sequence:CCGGTCCCTTGTGATTCTCAATGAACTCGAGTTCATTGAGAATCACAAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172420.2-624s1c1
Sequence:CCGGGCCATGAAAGGCGTTAAGCATCTCGAGATGCTTAACGCCTTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172420
PPP1R1C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 1C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172420.2-1448s1c1
Sequence:CCGGGCCATCTATATTGTATCACTTCTCGAGAAGTGATACAATATAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172420.2-435s1c1
Sequence:CCGGCCTTTATTCCAGAGTCAGATTCTCGAGAATCTGACTCTGGAATAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172420.2-501s1c1
Sequence:CCGGGCATCCCTTGTGATTCTCAATCTCGAGATTGAGAATCACAAGGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172420.2-504s1c1
Sequence:CCGGTCCCTTGTGATTCTCAATGAACTCGAGTTCATTGAGAATCACAAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172420.2-624s1c1
Sequence:CCGGGCCATGAAAGGCGTTAAGCATCTCGAGATGCTTAACGCCTTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_087137
PPP1R1C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 1C
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-511s1c1
Sequence:CCGGGAATCAGCATTCCCTGAAGAACTCGAGTTCTTCAGGGAATGCTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-292s1c1
Sequence:CCGGCAGAGTCAGATTGCACCTGAACTCGAGTTCAGGTGCAATCTGACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-349s1c1
Sequence:CCGGGCATCACTTGTGATTCTCAATCTCGAGATTGAGAATCACAAGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-283s1c1
Sequence:CCGGCCTGTATTCCAGAGTCAGATTCTCGAGAATCTGACTCTGGAATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-439s1c1
Sequence:CCGGCCTAAGCAAAGGAAGCAGAGTCTCGAGACTCTGCTTCCTTTGCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-292s1c2
Sequence:CCGGCAGAGTCAGATTGCACCTGAACTCGAGTTCAGGTGCAATCTGACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_087137
PPP1R1C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 1C
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-511s1c1
Sequence:CCGGGAATCAGCATTCCCTGAAGAACTCGAGTTCTTCAGGGAATGCTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-292s1c1
Sequence:CCGGCAGAGTCAGATTGCACCTGAACTCGAGTTCAGGTGCAATCTGACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-349s1c1
Sequence:CCGGGCATCACTTGTGATTCTCAATCTCGAGATTGAGAATCACAAGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-283s1c1
Sequence:CCGGCCTGTATTCCAGAGTCAGATTCTCGAGAATCTGACTCTGGAATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-439s1c1
Sequence:CCGGCCTAAGCAAAGGAAGCAGAGTCTCGAGACTCTGCTTCCTTTGCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-292s1c2
Sequence:CCGGCAGAGTCAGATTGCACCTGAACTCGAGTTCAGGTGCAATCTGACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_087137
PPP1R1C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 1C
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-511s1c1
Sequence:CCGGGAATCAGCATTCCCTGAAGAACTCGAGTTCTTCAGGGAATGCTGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-292s1c1
Sequence:CCGGCAGAGTCAGATTGCACCTGAACTCGAGTTCAGGTGCAATCTGACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-349s1c1
Sequence:CCGGGCATCACTTGTGATTCTCAATCTCGAGATTGAGAATCACAAGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-283s1c1
Sequence:CCGGCCTGTATTCCAGAGTCAGATTCTCGAGAATCTGACTCTGGAATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-439s1c1
Sequence:CCGGCCTAAGCAAAGGAAGCAGAGTCTCGAGACTCTGCTTCCTTTGCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_087137.7-292s1c2
Sequence:CCGGCAGAGTCAGATTGCACCTGAACTCGAGTTCAGGTGCAATCTGACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)