EMAIL THIS PAGE TO A FRIEND

PPP1R21

protein phosphatase 1, regulatory subunit 21

93 Gene Product Result for
Synonyms: CCDC128 KLRAQ1
Gene ID:
Mouse(73825) protein phosphatase 1, regulatory subunit 21
Rat(362697) protein phosphatase 1, regulatory subunit 21
cow(513495) protein phosphatase 1, regulatory subunit 21
sheep(101106669) protein phosphatase 1, regulatory subunit 21
domestic guinea pig(100730556) protein phosphatase 1, regulatory subunit 21
naked mole-rat(101710638) protein phosphatase 1, regulatory subunit 21
chicken(421287) protein phosphatase 1, regulatory subunit 21
domestic cat(101082997) protein phosphatase 1, regulatory subunit 21
dog(474586) protein phosphatase 1, regulatory subunit 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152994 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028658 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028658 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028658 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152994 Rosetta Predictions human pricing
XM_001057346 Rosetta Predictions rat pricing
XM_343014 Rosetta Predictions rat pricing
NM_028658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204529 predicted 284
2 SASI_Hs02_00366943 predicted 2308
3 SASI_Hs01_00204531 predicted 1434
4 SASI_Hs02_00366944 predicted 499
5 SASI_Hs01_00204532 predicted 1240
6 SASI_Hs02_00366945 predicted 348
7 SASI_Hs01_00204533 predicted 2352
8 SASI_Hs01_00204534 predicted 2438
9 SASI_Hs01_00204535 predicted 2173
10 SASI_Hs02_00366946 predicted 797
11 SASI_Hs01_00204527 predicted 1574
12 SASI_Hs01_00204528 predicted 1976
13 SASI_Hs01_00204530 predicted 1651
14 SASI_Hs01_00204536 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286107 predicted 1249
2 SASI_Rn02_00286108 predicted 882
3 SASI_Rn02_00286109 predicted 547
4 SASI_Rn02_00286110 predicted 1132
5 SASI_Rn02_00286111 predicted 2191
6 SASI_Rn02_00286112 predicted 809
7 SASI_Rn02_00286113 predicted 1187
8 SASI_Rn02_00286114 predicted 1284
9 SASI_Rn02_00286115 predicted 1509
10 SASI_Rn02_00286116 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395191 predicted 420
2 SASI_Rn02_00395192 predicted 308
3 SASI_Rn02_00395193 predicted 1725
4 SASI_Rn02_00395194 predicted 1364
5 SASI_Rn02_00395195 predicted 354
6 SASI_Rn02_00395196 predicted 315
7 SASI_Rn02_00395197 predicted 1745
8 SASI_Rn02_00395198 predicted 460
9 SASI_Rn02_00395199 predicted 681
10 SASI_Rn02_00395200 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028821 predicted 1061
2 SASI_Mm02_00334183 predicted 849
3 SASI_Mm01_00028823 predicted 1331
4 SASI_Mm01_00028824 predicted 2004
5 SASI_Mm01_00028825 predicted 1391
6 SASI_Mm01_00028826 predicted 991
7 SASI_Mm02_00334184 predicted 1461
8 SASI_Mm01_00028827 predicted 585
9 SASI_Mm01_00028828 predicted 618
10 SASI_Mm01_00028830 predicted 2182
11 SASI_Mm01_00028822 predicted 1357
12 SASI_Mm01_00028829 predicted 968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152994
VALIDATED
PPP1R21 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 21
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-2611s1c1
Sequence:CCGGCCTAGTAAACTAGTCAGTGTTCTCGAGAACACTGACTAGTTTACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-2366s1c1
Sequence:CCGGCGAGGATCAGTTAAGTATGATCTCGAGATCATACTTAACTGATCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-1051s1c1
Sequence:CCGGCCATTGACACTATATCTCCATCTCGAGATGGAGATATAGTGTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-1422s21c1
Sequence:CCGGGATGGACTCCTTCGGACAAACCTCGAGGTTTGTCCGAAGGAGTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-543s21c1
Sequence:CCGGGAACGGTTGCATATACAATTTCTCGAGAAATTGTATATGCAACCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-2404s1c1
Sequence:CCGGGCATGAATGAGACATTATCTACTCGAGTAGATAATGTCTCATTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-2843s1c1
Sequence:CCGGCGATTTGGTATCTATGGAATACTCGAGTATTCCATAGATACCAAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-1563s1c1
Sequence:CCGGCAGAAGCTGATAACAACTAATCTCGAGATTAGTTGTTATCAGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-1702s1c1
Sequence:CCGGGTGGATTCATTAGTCCTCTTTCTCGAGAAAGAGGACTAATGAATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-771s1c1
Sequence:CCGGCGAACGGAAGAATGTCAATTACTCGAGTAATTGACATTCTTCCGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-2583s1c1
Sequence:CCGGGCCTTCAGGAAGCTAAAGTATCTCGAGATACTTTAGCTTCCTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-2205s1c1
Sequence:CCGGGCTGACAGTAAGTCAGTGCATCTCGAGATGCACTGACTTACTGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-2135s21c1
Sequence:CCGGATCTCGTGAAGACTTAATTAACTCGAGTTAATTAAGTCTTCACGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-1297s21c1
Sequence:CCGGCTCTTTGCACATCTGCGTTAACTCGAGTTAACGCAGATGTGCAAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-1490s21c1
Sequence:CCGGTGACGTTATGAAAGATATTTCCTCGAGGAAATATCTTTCATAACGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-1249s21c1
Sequence:CCGGAGATTCTTCCCTATCAGTTAACTCGAGTTAACTGATAGGGAAGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-931s21c1
Sequence:CCGGAGCTGAAGATGCGAGATATTGCTCGAGCAATATCTCGCATCTTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-901s21c1
Sequence:CCGGTGAACGTTCCACTCCACAATACTCGAGTATTGTGGAGTGGAACGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152994
VALIDATED
PPP1R21 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 21
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-2611s1c1
Sequence:CCGGCCTAGTAAACTAGTCAGTGTTCTCGAGAACACTGACTAGTTTACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-2366s1c1
Sequence:CCGGCGAGGATCAGTTAAGTATGATCTCGAGATCATACTTAACTGATCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-1051s1c1
Sequence:CCGGCCATTGACACTATATCTCCATCTCGAGATGGAGATATAGTGTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-1422s21c1
Sequence:CCGGGATGGACTCCTTCGGACAAACCTCGAGGTTTGTCCGAAGGAGTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-543s21c1
Sequence:CCGGGAACGGTTGCATATACAATTTCTCGAGAAATTGTATATGCAACCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-2404s1c1
Sequence:CCGGGCATGAATGAGACATTATCTACTCGAGTAGATAATGTCTCATTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-2843s1c1
Sequence:CCGGCGATTTGGTATCTATGGAATACTCGAGTATTCCATAGATACCAAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-1563s1c1
Sequence:CCGGCAGAAGCTGATAACAACTAATCTCGAGATTAGTTGTTATCAGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-1702s1c1
Sequence:CCGGGTGGATTCATTAGTCCTCTTTCTCGAGAAAGAGGACTAATGAATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-771s1c1
Sequence:CCGGCGAACGGAAGAATGTCAATTACTCGAGTAATTGACATTCTTCCGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-2583s1c1
Sequence:CCGGGCCTTCAGGAAGCTAAAGTATCTCGAGATACTTTAGCTTCCTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-2205s1c1
Sequence:CCGGGCTGACAGTAAGTCAGTGCATCTCGAGATGCACTGACTTACTGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-2135s21c1
Sequence:CCGGATCTCGTGAAGACTTAATTAACTCGAGTTAATTAAGTCTTCACGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-1297s21c1
Sequence:CCGGCTCTTTGCACATCTGCGTTAACTCGAGTTAACGCAGATGTGCAAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-1490s21c1
Sequence:CCGGTGACGTTATGAAAGATATTTCCTCGAGGAAATATCTTTCATAACGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-1249s21c1
Sequence:CCGGAGATTCTTCCCTATCAGTTAACTCGAGTTAACTGATAGGGAAGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-931s21c1
Sequence:CCGGAGCTGAAGATGCGAGATATTGCTCGAGCAATATCTCGCATCTTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-901s21c1
Sequence:CCGGTGAACGTTCCACTCCACAATACTCGAGTATTGTGGAGTGGAACGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152994
VALIDATED
PPP1R21 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 21
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-2611s1c1
Sequence:CCGGCCTAGTAAACTAGTCAGTGTTCTCGAGAACACTGACTAGTTTACTAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-2366s1c1
Sequence:CCGGCGAGGATCAGTTAAGTATGATCTCGAGATCATACTTAACTGATCCTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-1051s1c1
Sequence:CCGGCCATTGACACTATATCTCCATCTCGAGATGGAGATATAGTGTCAATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-1422s21c1
Sequence:CCGGGATGGACTCCTTCGGACAAACCTCGAGGTTTGTCCGAAGGAGTCCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000433993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-543s21c1
Sequence:CCGGGAACGGTTGCATATACAATTTCTCGAGAAATTGTATATGCAACCGTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000159146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-2404s1c1
Sequence:CCGGGCATGAATGAGACATTATCTACTCGAGTAGATAATGTCTCATTCATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000160197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-2843s1c1
Sequence:CCGGCGATTTGGTATCTATGGAATACTCGAGTATTCCATAGATACCAAATCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000160578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-1563s1c1
Sequence:CCGGCAGAAGCTGATAACAACTAATCTCGAGATTAGTTGTTATCAGCTTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000161022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-1702s1c1
Sequence:CCGGGTGGATTCATTAGTCCTCTTTCTCGAGAAAGAGGACTAATGAATCCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000161152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-771s1c1
Sequence:CCGGCGAACGGAAGAATGTCAATTACTCGAGTAATTGACATTCTTCCGTTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000163353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_152994.2-2583s1c1
Sequence:CCGGGCCTTCAGGAAGCTAAAGTATCTCGAGATACTTTAGCTTCCTGAAGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000166013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152994.2-2205s1c1
Sequence:CCGGGCTGACAGTAAGTCAGTGCATCTCGAGATGCACTGACTTACTGTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000415813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-2135s21c1
Sequence:CCGGATCTCGTGAAGACTTAATTAACTCGAGTTAATTAAGTCTTCACGAGATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-1297s21c1
Sequence:CCGGCTCTTTGCACATCTGCGTTAACTCGAGTTAACGCAGATGTGCAAAGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-1490s21c1
Sequence:CCGGTGACGTTATGAAAGATATTTCCTCGAGGAAATATCTTTCATAACGTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-1249s21c1
Sequence:CCGGAGATTCTTCCCTATCAGTTAACTCGAGTTAACTGATAGGGAAGAATCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000424463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-931s21c1
Sequence:CCGGAGCTGAAGATGCGAGATATTGCTCGAGCAATATCTCGCATCTTCAGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152994.3-901s21c1
Sequence:CCGGTGAACGTTCCACTCCACAATACTCGAGTATTGTGGAGTGGAACGTTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028658
VALIDATED
PPP1R21 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 21
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-890s1c1
Sequence:CCGGGAATCAGAAGTTCTCCCAATACTCGAGTATTGGGAGAACTTCTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028658.3-889s21c1
Sequence:CCGGGAATCAGAAGTTCTCCCAATACTCGAGTATTGGGAGAACTTCTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028658.3-2725s21c1
Sequence:CCGGGCTTAAATTGTCAGATGTCATCTCGAGATGACATCTGACAATTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-2737s1c1
Sequence:CCGGCAGATGTCATTACTTCCTGTACTCGAGTACAGGAAGTAATGACATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-2726s1c1
Sequence:CCGGGCTTAAATTGTCAGATGTCATCTCGAGATGACATCTGACAATTTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-957s1c1
Sequence:CCGGCTGCACTTATTCGAGAGCATTCTCGAGAATGCTCTCGAATAAGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-2477s1c1
Sequence:CCGGCCTGGAGACCTTTGAAGAATACTCGAGTATTCTTCAAAGGTCTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028658.3-1984s21c1
Sequence:CCGGGTCCCGTGAAGACCTAATTAACTCGAGTTAATTAGGTCTTCACGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028658.3-2476s21c1
Sequence:CCGGCCTGGAGACCTTTGAAGAATACTCGAGTATTCTTCAAAGGTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028658
VALIDATED
PPP1R21 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 21
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-890s1c1
Sequence:CCGGGAATCAGAAGTTCTCCCAATACTCGAGTATTGGGAGAACTTCTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028658.3-889s21c1
Sequence:CCGGGAATCAGAAGTTCTCCCAATACTCGAGTATTGGGAGAACTTCTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028658.3-2725s21c1
Sequence:CCGGGCTTAAATTGTCAGATGTCATCTCGAGATGACATCTGACAATTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-2737s1c1
Sequence:CCGGCAGATGTCATTACTTCCTGTACTCGAGTACAGGAAGTAATGACATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-2726s1c1
Sequence:CCGGGCTTAAATTGTCAGATGTCATCTCGAGATGACATCTGACAATTTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-957s1c1
Sequence:CCGGCTGCACTTATTCGAGAGCATTCTCGAGAATGCTCTCGAATAAGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-2477s1c1
Sequence:CCGGCCTGGAGACCTTTGAAGAATACTCGAGTATTCTTCAAAGGTCTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028658.3-1984s21c1
Sequence:CCGGGTCCCGTGAAGACCTAATTAACTCGAGTTAATTAGGTCTTCACGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028658.3-2476s21c1
Sequence:CCGGCCTGGAGACCTTTGAAGAATACTCGAGTATTCTTCAAAGGTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028658
VALIDATED
PPP1R21 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 21
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-890s1c1
Sequence:CCGGGAATCAGAAGTTCTCCCAATACTCGAGTATTGGGAGAACTTCTGATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028658.3-889s21c1
Sequence:CCGGGAATCAGAAGTTCTCCCAATACTCGAGTATTGGGAGAACTTCTGATTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000336452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028658.3-2725s21c1
Sequence:CCGGGCTTAAATTGTCAGATGTCATCTCGAGATGACATCTGACAATTTAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000191083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-2737s1c1
Sequence:CCGGCAGATGTCATTACTTCCTGTACTCGAGTACAGGAAGTAATGACATCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000191880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-2726s1c1
Sequence:CCGGGCTTAAATTGTCAGATGTCATCTCGAGATGACATCTGACAATTTAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000192103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-957s1c1
Sequence:CCGGCTGCACTTATTCGAGAGCATTCTCGAGAATGCTCTCGAATAAGTGCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000192443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028658.2-2477s1c1
Sequence:CCGGCCTGGAGACCTTTGAAGAATACTCGAGTATTCTTCAAAGGTCTCCAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000336453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028658.3-1984s21c1
Sequence:CCGGGTCCCGTGAAGACCTAATTAACTCGAGTTAATTAGGTCTTCACGGGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000336451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028658.3-2476s21c1
Sequence:CCGGCCTGGAGACCTTTGAAGAATACTCGAGTATTCTTCAAAGGTCTCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???