EMAIL THIS PAGE TO A FRIEND

PPP1R27

protein phosphatase 1, regulatory subunit 27

82 Gene Product Result for
Synonyms: DYSFIP1
UniProtKB ID: Q86WC6
Gene ID:
Mouse(68701) protein phosphatase 1, regulatory subunit 27
Rat(287881) protein phosphatase 1, regulatory subunit 27
Zebrafish(559662) protein phosphatase 1, regulatory subunit 27
domestic cat(101089478) protein phosphatase 1, regulatory subunit 27
dog(608003) protein phosphatase 1, regulatory subunit 27
chicken(422092) protein phosphatase 1, regulatory subunit 27
cow(616223) protein phosphatase 1, regulatory subunit 27
sheep(101115471) protein phosphatase 1, regulatory subunit 27
domestic guinea pig(100733666) protein phosphatase 1, regulatory subunit 27
naked mole-rat(101711855) protein phosphatase 1, regulatory subunit 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007533 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151231 MISSION® esiRNA esiRNA human DYSFIP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007533 Rosetta Predictions human pricing
NM_001105858 Rosetta Predictions rat pricing
NM_026814 Rosetta Predictions mouse pricing
XM_126635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177599 predicted 320
2 SASI_Hs01_00177600 predicted 239
3 SASI_Hs01_00177601 predicted 252
4 SASI_Hs01_00177602 predicted 331
5 SASI_Hs01_00177603 predicted 291
6 SASI_Hs01_00177605 predicted 322
7 SASI_Hs01_00177606 predicted 279
8 SASI_Hs02_00305324 predicted 205
9 SASI_Hs01_00177604 predicted 315
10 SASI_Hs01_00177607 predicted 308
11 SASI_Hs01_00177608 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213222 predicted 340
2 SASI_Rn02_00213223 predicted 423
3 SASI_Rn02_00213224 predicted 247
4 SASI_Rn02_00213225 predicted 352
5 SASI_Rn02_00213226 predicted 324
6 SASI_Rn02_00213227 predicted 422
7 SASI_Rn02_00213228 predicted 463
8 SASI_Rn02_00213229 predicted 396
9 SASI_Rn02_00213230 predicted 464
10 SASI_Rn02_00213231 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330948 predicted 233
2 SASI_Mm02_00330949 predicted 226
3 SASI_Mm02_00330950 predicted 475
4 SASI_Mm02_00330951 predicted 408
5 SASI_Mm02_00330952 predicted 227
6 SASI_Mm02_00330953 predicted 413
7 SASI_Mm02_00330954 predicted 340
8 SASI_Mm02_00330955 predicted 465
9 SASI_Mm02_00330956 predicted 465
10 SASI_Mm02_00330957 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284280 predicted 237
2 SASI_Mm01_00284281 predicted 232
3 SASI_Mm01_00284282 predicted 415
4 SASI_Mm01_00284283 predicted 234
5 SASI_Mm01_00284284 predicted 413
6 SASI_Mm01_00284285 predicted 341
7 SASI_Mm01_00284286 predicted 315
8 SASI_Mm01_00284287 predicted 218
9 SASI_Mm01_00284288 predicted 396
10 SASI_Mm01_00284289 predicted 407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007533
PPP1R27 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 27
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000262644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007533.3-241s21c1
Sequence:CCGGCTTCATCCGGACTCGGAAAGTCTCGAGACTTTCCGAGTCCGGATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007533.3-335s21c1
Sequence:CCGGGTGAAGCTGCTGGTCAAATACCTCGAGGTATTTGACCAGCAGCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007533.3-170s21c1
Sequence:CCGGAGCGTGCGTTTCCCTAATGATCTCGAGATCATTAGGGAAACGCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007533.3-359s21c1
Sequence:CCGGGCTGACATTCACCAGCGAGATCTCGAGATCTCGCTGGTGAATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007533
PPP1R27 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 27
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000262644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007533.3-241s21c1
Sequence:CCGGCTTCATCCGGACTCGGAAAGTCTCGAGACTTTCCGAGTCCGGATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007533.3-335s21c1
Sequence:CCGGGTGAAGCTGCTGGTCAAATACCTCGAGGTATTTGACCAGCAGCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007533.3-170s21c1
Sequence:CCGGAGCGTGCGTTTCCCTAATGATCTCGAGATCATTAGGGAAACGCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007533.3-359s21c1
Sequence:CCGGGCTGACATTCACCAGCGAGATCTCGAGATCTCGCTGGTGAATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007533
PPP1R27 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 27
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000262644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007533.3-241s21c1
Sequence:CCGGCTTCATCCGGACTCGGAAAGTCTCGAGACTTTCCGAGTCCGGATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007533.3-335s21c1
Sequence:CCGGGTGAAGCTGCTGGTCAAATACCTCGAGGTATTTGACCAGCAGCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007533.3-170s21c1
Sequence:CCGGAGCGTGCGTTTCCCTAATGATCTCGAGATCATTAGGGAAACGCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007533.3-359s21c1
Sequence:CCGGGCTGACATTCACCAGCGAGATCTCGAGATCTCGCTGGTGAATGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026814
PPP1R27 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 27
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-411s21c1
Sequence:CCGGACATAGCCAGGTATCTCATCTCTCGAGAGATGAGATACCTGGCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-224s21c1
Sequence:CCGGTTTATCCGGGCTCGGAAAGTCCTCGAGGACTTTCCGAGCCCGGATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-155s21c1
Sequence:CCGGGTGCGCTTCCCTAACGATGTTCTCGAGAACATCGTTAGGGAAGCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026814.3-573s21c1
Sequence:CCGGTCCTTGGAGAAGTGGCAAGCACTCGAGTGCTTGCCACTTCTCCAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-315s21c1
Sequence:GTACCGGGTGTGAAGTTGCTAGTCAAATCTCGAGATTTGACTAGCAACTTCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-470s21c1
Sequence:CCGGGATCTGCCCTCCGACCTTATTCTCGAGAATAAGGTCGGAGGGCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-507s21c1
Sequence:CCGGACTTGGTGGAACTCTTCAAAGCTCGAGCTTTGAAGAGTTCCACCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026814
PPP1R27 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 27
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-411s21c1
Sequence:CCGGACATAGCCAGGTATCTCATCTCTCGAGAGATGAGATACCTGGCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-224s21c1
Sequence:CCGGTTTATCCGGGCTCGGAAAGTCCTCGAGGACTTTCCGAGCCCGGATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-155s21c1
Sequence:CCGGGTGCGCTTCCCTAACGATGTTCTCGAGAACATCGTTAGGGAAGCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026814.3-573s21c1
Sequence:CCGGTCCTTGGAGAAGTGGCAAGCACTCGAGTGCTTGCCACTTCTCCAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-315s21c1
Sequence:GTACCGGGTGTGAAGTTGCTAGTCAAATCTCGAGATTTGACTAGCAACTTCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-470s21c1
Sequence:CCGGGATCTGCCCTCCGACCTTATTCTCGAGAATAAGGTCGGAGGGCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-507s21c1
Sequence:CCGGACTTGGTGGAACTCTTCAAAGCTCGAGCTTTGAAGAGTTCCACCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026814
PPP1R27 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 27
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-411s21c1
Sequence:CCGGACATAGCCAGGTATCTCATCTCTCGAGAGATGAGATACCTGGCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-224s21c1
Sequence:CCGGTTTATCCGGGCTCGGAAAGTCCTCGAGGACTTTCCGAGCCCGGATAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-155s21c1
Sequence:CCGGGTGCGCTTCCCTAACGATGTTCTCGAGAACATCGTTAGGGAAGCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026814.3-573s21c1
Sequence:CCGGTCCTTGGAGAAGTGGCAAGCACTCGAGTGCTTGCCACTTCTCCAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-315s21c1
Sequence:GTACCGGGTGTGAAGTTGCTAGTCAAATCTCGAGATTTGACTAGCAACTTCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-470s21c1
Sequence:CCGGGATCTGCCCTCCGACCTTATTCTCGAGAATAAGGTCGGAGGGCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026814.3-507s21c1
Sequence:CCGGACTTGGTGGAACTCTTCAAAGCTCGAGCTTTGAAGAGTTCCACCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)