EMAIL THIS PAGE TO A FRIEND

PPP1R2

protein phosphatase 1, regulatory (inhibitor) subunit 2

187 Gene Product Result for
Synonyms: IPP-2 IPP2
UniProtKB ID: P41236
Gene ID:
Mouse(66849) protein phosphatase 1, regulatory (inhibitor) subunit 2
Rat(192361) protein phosphatase 1, regulatory (inhibitor) subunit 2
Zebrafish(402967) protein phosphatase 1, regulatory (inhibitor) subunit 2
dog(478605) protein phosphatase 1, regulatory (inhibitor) subunit 2
domestic cat(101085653) protein phosphatase 1, regulatory (inhibitor) subunit 2
chicken(424894) protein phosphatase 1, regulatory (inhibitor) subunit 2
domestic guinea pig(100735405) protein phosphatase 1, regulatory (inhibitor) subunit 2
naked mole-rat(101708807) protein phosphatase 1, regulatory (inhibitor) subunit 2
Domestic Rabbit(100009520) protein phosphatase 1, regulatory (inhibitor) subunit 2
cow(532726) protein phosphatase 1, regulatory (inhibitor) subunit 2
sheep(101104622) protein phosphatase 1, regulatory (inhibitor) subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006241 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006241 siRNAs that have been validated in the lab human pricing
NM_138823 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006241 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135974 validated 511
2 SASI_Hs01_00135975 predicted 514
3 SASI_Hs01_00135976 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115630 predicted 728
2 SASI_Rn01_00115631 predicted 624
3 SASI_Rn01_00115632 predicted 316
4 SASI_Rn01_00115633 predicted 342
5 SASI_Rn01_00115634 predicted 463
6 SASI_Rn01_00115635 predicted 409
7 SASI_Rn01_00115636 predicted 778
8 SASI_Rn01_00115637 predicted 735
9 SASI_Rn01_00115638 predicted 754
10 SASI_Rn01_00115639 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025800
VALIDATED
PPP1R2 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025800.2-848s1c1
Sequence:CCGGGCATGAATGTTGAAGAGTCAACTCGAGTTGACTCTTCAACATTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025800.2-592s1c1
Sequence:CCGGCCAGATATCTTAGCTAAGAAACTCGAGTTTCTTAGCTAAGATATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025800.2-477s1c1
Sequence:CCGGCGCTGACAAAGACTATGGCTTCTCGAGAAGCCATAGTCTTTGTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025800.2-2236s1c1
Sequence:CCGGGCACCAAATGAATCTGTTATACTCGAGTATAACAGATTCATTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025800.2-327s1c1
Sequence:CCGGGCCCATCAAAGGAATCCTGAACTCGAGTTCAGGATTCCTTTGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-458s21c1
Sequence:CCGGATGAATATCCTGGCAACATATCTCGAGATATGTTGCCAGGATATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-751s21c1
Sequence:CCGGTTACAATGAAGGACTCAATATCTCGAGATATTGAGTCCTTCATTGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-550s21c1
Sequence:CCGGTGACGATGAAGACGCCTATAGCTCGAGCTATAGGCGTCTTCATCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-774s21c1
Sequence:CCGGAGTTAGCCAGACAGTTAATTTCTCGAGAAATTAACTGTCTGGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025800.3-1102s21c1
Sequence:CCGGATATTCTTGTGCCTCATATTTCTCGAGAAATATGAGGCACAAGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-908s21c1
Sequence:CCGGCACAAATCACAAAGTTCATAACTCGAGTTATGAACTTTGTGATTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-672s21c1
Sequence:CCGGGTAGTGGAGAGGAAGATAATGCTCGAGCATTATCTTCCTCTCCACTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025800
VALIDATED
PPP1R2 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025800.2-848s1c1
Sequence:CCGGGCATGAATGTTGAAGAGTCAACTCGAGTTGACTCTTCAACATTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025800.2-592s1c1
Sequence:CCGGCCAGATATCTTAGCTAAGAAACTCGAGTTTCTTAGCTAAGATATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025800.2-477s1c1
Sequence:CCGGCGCTGACAAAGACTATGGCTTCTCGAGAAGCCATAGTCTTTGTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025800.2-2236s1c1
Sequence:CCGGGCACCAAATGAATCTGTTATACTCGAGTATAACAGATTCATTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025800.2-327s1c1
Sequence:CCGGGCCCATCAAAGGAATCCTGAACTCGAGTTCAGGATTCCTTTGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-458s21c1
Sequence:CCGGATGAATATCCTGGCAACATATCTCGAGATATGTTGCCAGGATATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-751s21c1
Sequence:CCGGTTACAATGAAGGACTCAATATCTCGAGATATTGAGTCCTTCATTGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-550s21c1
Sequence:CCGGTGACGATGAAGACGCCTATAGCTCGAGCTATAGGCGTCTTCATCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-774s21c1
Sequence:CCGGAGTTAGCCAGACAGTTAATTTCTCGAGAAATTAACTGTCTGGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025800.3-1102s21c1
Sequence:CCGGATATTCTTGTGCCTCATATTTCTCGAGAAATATGAGGCACAAGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-908s21c1
Sequence:CCGGCACAAATCACAAAGTTCATAACTCGAGTTATGAACTTTGTGATTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-672s21c1
Sequence:CCGGGTAGTGGAGAGGAAGATAATGCTCGAGCATTATCTTCCTCTCCACTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025800
VALIDATED
PPP1R2 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025800.2-848s1c1
Sequence:CCGGGCATGAATGTTGAAGAGTCAACTCGAGTTGACTCTTCAACATTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025800.2-592s1c1
Sequence:CCGGCCAGATATCTTAGCTAAGAAACTCGAGTTTCTTAGCTAAGATATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025800.2-477s1c1
Sequence:CCGGCGCTGACAAAGACTATGGCTTCTCGAGAAGCCATAGTCTTTGTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025800.2-2236s1c1
Sequence:CCGGGCACCAAATGAATCTGTTATACTCGAGTATAACAGATTCATTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025800.2-327s1c1
Sequence:CCGGGCCCATCAAAGGAATCCTGAACTCGAGTTCAGGATTCCTTTGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-458s21c1
Sequence:CCGGATGAATATCCTGGCAACATATCTCGAGATATGTTGCCAGGATATTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-751s21c1
Sequence:CCGGTTACAATGAAGGACTCAATATCTCGAGATATTGAGTCCTTCATTGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-550s21c1
Sequence:CCGGTGACGATGAAGACGCCTATAGCTCGAGCTATAGGCGTCTTCATCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-774s21c1
Sequence:CCGGAGTTAGCCAGACAGTTAATTTCTCGAGAAATTAACTGTCTGGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025800.3-1102s21c1
Sequence:CCGGATATTCTTGTGCCTCATATTTCTCGAGAAATATGAGGCACAAGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-908s21c1
Sequence:CCGGCACAAATCACAAAGTTCATAACTCGAGTTATGAACTTTGTGATTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025800.3-672s21c1
Sequence:CCGGGTAGTGGAGAGGAAGATAATGCTCGAGCATTATCTTCCTCTCCACTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006241
VALIDATED
PPP1R2 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006241.3-2140s1c1
Sequence:CCGGCGCAGTAAGAATTAGGTGGAACTCGAGTTCCACCTAATTCTTACTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006241.3-779s1c1
Sequence:CCGGCGGAAGAATCAAATCAAGGATCTCGAGATCCTTGATTTGATTCTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006241.3-514s1c1
Sequence:CCGGCCAGACATCTTAGCCAGGAAACTCGAGTTTCCTGGCTAAGATGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006241.3-400s1c1
Sequence:CCGGGCAGACAAAGACTATGGTTTACTCGAGTAAACCATAGTCTTTGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006241.3-718s1c1
Sequence:CCGGCTACATGATGATGATGAAGATCTCGAGATCTTCATCATCATCATGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006241.4-923s21c1
Sequence:GTACCGGATGAATACGGAAGAATCAAATCTCGAGATTTGATTCTTCCGTATTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006241.4-983s21c1
Sequence:CCGGCGAAGTTCATAGACGAGATTTCTCGAGAAATCTCGTCTATGAACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006241.4-817s21c1
Sequence:CCGGCTACAATGAAGGACTCAATATCTCGAGATATTGAGTCCTTCATTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006241.4-869s21c1
Sequence:CCGGCTACATGATGATGATGAAGATCTCGAGATCTTCATCATCATCATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006241.4-590s21c1
Sequence:CCGGAGCACTCCTTACCATAGTATGCTCGAGCATACTATGGTAAGGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006241.4-1179s21c1
Sequence:CCGGATTCTTGTGCCTAGTACTTTACTCGAGTAAAGTACTAGGCACAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006241.4-666s21c1
Sequence:GTACCGGCAGACATCTTAGCCAGGAAATCTCGAGATTTCCTGGCTAAGATGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006241
VALIDATED
PPP1R2 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006241.3-2140s1c1
Sequence:CCGGCGCAGTAAGAATTAGGTGGAACTCGAGTTCCACCTAATTCTTACTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006241.3-779s1c1
Sequence:CCGGCGGAAGAATCAAATCAAGGATCTCGAGATCCTTGATTTGATTCTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006241.3-514s1c1
Sequence:CCGGCCAGACATCTTAGCCAGGAAACTCGAGTTTCCTGGCTAAGATGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006241.3-400s1c1
Sequence:CCGGGCAGACAAAGACTATGGTTTACTCGAGTAAACCATAGTCTTTGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006241.3-718s1c1
Sequence:CCGGCTACATGATGATGATGAAGATCTCGAGATCTTCATCATCATCATGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006241.4-923s21c1
Sequence:GTACCGGATGAATACGGAAGAATCAAATCTCGAGATTTGATTCTTCCGTATTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006241.4-983s21c1
Sequence:CCGGCGAAGTTCATAGACGAGATTTCTCGAGAAATCTCGTCTATGAACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006241.4-817s21c1
Sequence:CCGGCTACAATGAAGGACTCAATATCTCGAGATATTGAGTCCTTCATTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006241.4-869s21c1
Sequence:CCGGCTACATGATGATGATGAAGATCTCGAGATCTTCATCATCATCATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006241.4-590s21c1
Sequence:CCGGAGCACTCCTTACCATAGTATGCTCGAGCATACTATGGTAAGGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006241.4-1179s21c1
Sequence:CCGGATTCTTGTGCCTAGTACTTTACTCGAGTAAAGTACTAGGCACAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006241.4-666s21c1
Sequence:GTACCGGCAGACATCTTAGCCAGGAAATCTCGAGATTTCCTGGCTAAGATGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006241
VALIDATED
PPP1R2 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006241.3-2140s1c1
Sequence:CCGGCGCAGTAAGAATTAGGTGGAACTCGAGTTCCACCTAATTCTTACTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006241.3-779s1c1
Sequence:CCGGCGGAAGAATCAAATCAAGGATCTCGAGATCCTTGATTTGATTCTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006241.3-514s1c1
Sequence:CCGGCCAGACATCTTAGCCAGGAAACTCGAGTTTCCTGGCTAAGATGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006241.3-400s1c1
Sequence:CCGGGCAGACAAAGACTATGGTTTACTCGAGTAAACCATAGTCTTTGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006241.3-718s1c1
Sequence:CCGGCTACATGATGATGATGAAGATCTCGAGATCTTCATCATCATCATGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006241.4-923s21c1
Sequence:GTACCGGATGAATACGGAAGAATCAAATCTCGAGATTTGATTCTTCCGTATTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006241.4-983s21c1
Sequence:CCGGCGAAGTTCATAGACGAGATTTCTCGAGAAATCTCGTCTATGAACTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006241.4-817s21c1
Sequence:CCGGCTACAATGAAGGACTCAATATCTCGAGATATTGAGTCCTTCATTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006241.4-869s21c1
Sequence:CCGGCTACATGATGATGATGAAGATCTCGAGATCTTCATCATCATCATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006241.4-590s21c1
Sequence:CCGGAGCACTCCTTACCATAGTATGCTCGAGCATACTATGGTAAGGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006241.4-1179s21c1
Sequence:CCGGATTCTTGTGCCTAGTACTTTACTCGAGTAAAGTACTAGGCACAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006241.4-666s21c1
Sequence:GTACCGGCAGACATCTTAGCCAGGAAATCTCGAGATTTCCTGGCTAAGATGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)