EMAIL THIS PAGE TO A FRIEND

PPP1R35

protein phosphatase 1, regulatory subunit 35

40 Gene Product Result for
Synonyms: C7orf47
UniProtKB ID: Q8TAP8, A4D2C5
Gene ID:
Mouse(69871) protein phosphatase 1, regulatory subunit 35
Rat(684993) protein phosphatase 1, regulatory subunit 35
cow(617968) protein phosphatase 1, regulatory subunit 35
sheep(101105714) protein phosphatase 1, regulatory subunit 35
domestic guinea pig(100714851) protein phosphatase 1, regulatory subunit 35
naked mole-rat(101719894) protein phosphatase 1, regulatory subunit 35
domestic cat(101099922) protein phosphatase 1, regulatory subunit 35
dog(479735) protein phosphatase 1, regulatory subunit 35
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145030 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145030 Rosetta Predictions human pricing
NM_001109451 Rosetta Predictions rat pricing
NM_027242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050125 predicted 625
2 SASI_Hs01_00050126 predicted 566
3 SASI_Hs01_00050127 predicted 626
4 SASI_Hs01_00050128 predicted 628
5 SASI_Hs01_00050129 predicted 611
6 SASI_Hs01_00050130 predicted 615
7 SASI_Hs01_00050124 predicted 605
8 SASI_Hs01_00050131 predicted 598
9 SASI_Hs01_00050132 predicted 890
10 SASI_Hs01_00050133 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248537 predicted 233
2 SASI_Rn02_00248538 predicted 705
3 SASI_Rn02_00248539 predicted 613
4 SASI_Rn02_00248540 predicted 560
5 SASI_Rn02_00248541 predicted 244
6 SASI_Rn02_00248542 predicted 575
7 SASI_Rn02_00248543 predicted 456
8 SASI_Rn02_00248544 predicted 709
9 SASI_Rn02_00248545 predicted 202
10 SASI_Rn02_00248546 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130447 predicted 206
2 SASI_Mm01_00130448 predicted 367
3 SASI_Mm01_00130449 predicted 495
4 SASI_Mm02_00331818 predicted 208
5 SASI_Mm01_00130451 predicted 358
6 SASI_Mm01_00130452 predicted 439
7 SASI_Mm02_00331819 predicted 206
8 SASI_Mm01_00130454 predicted 611
9 SASI_Mm01_00130455 predicted 205
10 SASI_Mm01_00130456 predicted 552
11 SASI_Mm01_00130450 predicted 612
12 SASI_Mm01_00130453 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027242
PPP1R35 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 35
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-419s21c1
Sequence:CCGGTTGAGTCTGGAGCTGCAGAACCTCGAGGTTCTGCAGCTCCAGACTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-103s21c1
Sequence:CCGGAGAGTCCATTGAAGGCGAAGACTCGAGTCTTCGCCTTCAATGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-566s21c1
Sequence:CCGGTCTAAGCGACTCTACCGAGACCTCGAGGTCTCGGTAGAGTCGCTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-729s21c1
Sequence:CCGGCAGATTCTCTGTGGTCCGAATCTCGAGATTCGGACCACAGAGAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-491s21c1
Sequence:CCGGGAGCAGCTGAGAAAGTCGTTCCTCGAGGAACGACTTTCTCAGCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027242
PPP1R35 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 35
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-419s21c1
Sequence:CCGGTTGAGTCTGGAGCTGCAGAACCTCGAGGTTCTGCAGCTCCAGACTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-103s21c1
Sequence:CCGGAGAGTCCATTGAAGGCGAAGACTCGAGTCTTCGCCTTCAATGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-566s21c1
Sequence:CCGGTCTAAGCGACTCTACCGAGACCTCGAGGTCTCGGTAGAGTCGCTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-729s21c1
Sequence:CCGGCAGATTCTCTGTGGTCCGAATCTCGAGATTCGGACCACAGAGAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-491s21c1
Sequence:CCGGGAGCAGCTGAGAAAGTCGTTCCTCGAGGAACGACTTTCTCAGCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027242
PPP1R35 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 35
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-419s21c1
Sequence:CCGGTTGAGTCTGGAGCTGCAGAACCTCGAGGTTCTGCAGCTCCAGACTCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-103s21c1
Sequence:CCGGAGAGTCCATTGAAGGCGAAGACTCGAGTCTTCGCCTTCAATGGACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-566s21c1
Sequence:CCGGTCTAAGCGACTCTACCGAGACCTCGAGGTCTCGGTAGAGTCGCTTAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000283049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-729s21c1
Sequence:CCGGCAGATTCTCTGTGGTCCGAATCTCGAGATTCGGACCACAGAGAATCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027242.4-491s21c1
Sequence:CCGGGAGCAGCTGAGAAAGTCGTTCCTCGAGGAACGACTTTCTCAGCTGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145030
VALIDATED
PPP1R35 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 35
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_145030.2-744s21c1
Sequence:CCGGATGAATCTCCACACCTGACCCCTCGAGGGGTCAGGTGTGGAGATTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_145030.2-491s21c1
Sequence:CCGGGAACAGCTGAGAAAGTCGTTCCTCGAGGAACGACTTTCTCAGCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145030.2-700s21c1
Sequence:CCGGTGGGCCAGACATGACCATCTTCTCGAGAAGATGGTCATGTCTGGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_145030.2-722s21c1
Sequence:CCGGTGTGACCCAGAAACGCTATTTCTCGAGAAATAGCGTTTCTGGGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_145030.2-605s21c1
Sequence:CCGGCCGGAGGAACAGGTTCTGAATCTCGAGATTCAGAACCTGTTCCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145030
VALIDATED
PPP1R35 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 35
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_145030.2-744s21c1
Sequence:CCGGATGAATCTCCACACCTGACCCCTCGAGGGGTCAGGTGTGGAGATTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_145030.2-491s21c1
Sequence:CCGGGAACAGCTGAGAAAGTCGTTCCTCGAGGAACGACTTTCTCAGCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145030.2-700s21c1
Sequence:CCGGTGGGCCAGACATGACCATCTTCTCGAGAAGATGGTCATGTCTGGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_145030.2-722s21c1
Sequence:CCGGTGTGACCCAGAAACGCTATTTCTCGAGAAATAGCGTTTCTGGGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_145030.2-605s21c1
Sequence:CCGGCCGGAGGAACAGGTTCTGAATCTCGAGATTCAGAACCTGTTCCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145030
VALIDATED
PPP1R35 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 35
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_145030.2-744s21c1
Sequence:CCGGATGAATCTCCACACCTGACCCCTCGAGGGGTCAGGTGTGGAGATTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000268438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_145030.2-491s21c1
Sequence:CCGGGAACAGCTGAGAAAGTCGTTCCTCGAGGAACGACTTTCTCAGCTGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000268444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145030.2-700s21c1
Sequence:CCGGTGGGCCAGACATGACCATCTTCTCGAGAAGATGGTCATGTCTGGCCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000283709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_145030.2-722s21c1
Sequence:CCGGTGTGACCCAGAAACGCTATTTCTCGAGAAATAGCGTTTCTGGGTCACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000268445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_145030.2-605s21c1
Sequence:CCGGCCGGAGGAACAGGTTCTGAATCTCGAGATTCAGAACCTGTTCCTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???