EMAIL THIS PAGE TO A FRIEND

PPP1R36

protein phosphatase 1, regulatory subunit 36

64 Gene Product Result for
Synonyms: C14orf50
UniProtKB ID: Q96LQ0, Q6NTH6
Gene ID:
Mouse(210762) protein phosphatase 1, regulatory subunit 36
Rat(299153) protein phosphatase 1, regulatory subunit 36
chicken(776144) protein phosphatase 1, regulatory subunit 36
domestic cat(101095832) protein phosphatase 1, regulatory subunit 36
dog(611452) protein phosphatase 1, regulatory subunit 36
naked mole-rat(101701420) protein phosphatase 1, regulatory subunit 36
domestic guinea pig(100717845) protein phosphatase 1, regulatory subunit 36
cow(100141235) protein phosphatase 1, regulatory subunit 36
sheep(101119908) protein phosphatase 1, regulatory subunit 36
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172365 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172365 Rosetta Predictions human pricing
NM_001013944 Rosetta Predictions rat pricing
XM_898829 Rosetta Predictions mouse pricing
XM_923932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117065 predicted 552
2 SASI_Hs01_00117066 predicted 320
3 SASI_Hs01_00117068 predicted 208
4 SASI_Hs01_00117069 predicted 700
5 SASI_Hs01_00117070 predicted 835
6 SASI_Hs02_00368016 predicted 776
7 SASI_Hs01_00117071 predicted 438
8 SASI_Hs01_00117072 predicted 330
9 SASI_Hs01_00117073 predicted 568
10 SASI_Hs01_00117074 predicted 792
11 SASI_Hs01_00117067 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040539 predicted 259
2 SASI_Rn01_00040540 predicted 397
3 SASI_Rn01_00040541 predicted 1163
4 SASI_Rn01_00040542 predicted 446
5 SASI_Rn01_00040543 predicted 557
6 SASI_Rn01_00040544 predicted 1141
7 SASI_Rn01_00040545 predicted 1189
8 SASI_Rn01_00040546 predicted 1175
9 SASI_Rn01_00040547 predicted 674
10 SASI_Rn01_00040548 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279108 predicted 1216
2 SASI_Mm01_00279109 predicted 1240
3 SASI_Mm01_00279110 predicted 1111
4 SASI_Mm01_00279111 predicted 857
5 SASI_Mm01_00279112 predicted 1055
6 SASI_Mm01_00279113 predicted 916
7 SASI_Mm01_00279114 predicted 1154
8 SASI_Mm01_00279115 predicted 1260
9 SASI_Mm01_00279116 predicted 1085
10 SASI_Mm01_00279117 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_923932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444019 predicted 1215
2 SASI_Mm02_00444020 predicted 517
3 SASI_Mm02_00444021 predicted 1242
4 SASI_Mm02_00444022 predicted 1114
5 SASI_Mm02_00444023 predicted 1053
6 SASI_Mm02_00444024 predicted 1155
7 SASI_Mm02_00444025 predicted 748
8 SASI_Mm02_00444026 predicted 1266
9 SASI_Mm02_00444027 predicted 1150
10 SASI_Mm02_00444028 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172365
PPP1R36 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 36
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-414s21c1
Sequence:CCGGTGTAGAGAAACGAGGTCAACACTCGAGTGTTGACCTCGTTTCTCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-1105s21c1
Sequence:CCGGCATCAAGTAGACGTCAGATTCCTCGAGGAATCTGACGTCTACTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-441s21c1
Sequence:CCGGCATTACACTGGATGATGTTAACTCGAGTTAACATCATCCAGTGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-890s21c1
Sequence:CCGGGACTCTTTCGTACCAATATGTCTCGAGACATATTGGTACGAAAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-517s21c1
Sequence:CCGGACAACATTTATGAGGAATAAGCTCGAGCTTATTCCTCATAAATGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-1344s21c1
Sequence:CCGGTCATACATCATGCCCTAAGTACTCGAGTACTTAGGGCATGATGTATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172365.1-168s1c1
Sequence:CCGGGTTGGGATTACGATTAGGGATCTCGAGATCCCTAATCGTAATCCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172365.1-853s1c1
Sequence:CCGGCGTCAACACTTGACAGAGATTCTCGAGAATCTCTGTCAAGTGTTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172365.1-567s1c1
Sequence:CCGGGTACTACTTATCCCATTACTTCTCGAGAAGTAATGGGATAAGTAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172365.1-555s1c1
Sequence:CCGGCATGGCATTATTGTACTACTTCTCGAGAAGTAGTACAATAATGCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172365
PPP1R36 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 36
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-414s21c1
Sequence:CCGGTGTAGAGAAACGAGGTCAACACTCGAGTGTTGACCTCGTTTCTCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-1105s21c1
Sequence:CCGGCATCAAGTAGACGTCAGATTCCTCGAGGAATCTGACGTCTACTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-441s21c1
Sequence:CCGGCATTACACTGGATGATGTTAACTCGAGTTAACATCATCCAGTGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-890s21c1
Sequence:CCGGGACTCTTTCGTACCAATATGTCTCGAGACATATTGGTACGAAAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-517s21c1
Sequence:CCGGACAACATTTATGAGGAATAAGCTCGAGCTTATTCCTCATAAATGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-1344s21c1
Sequence:CCGGTCATACATCATGCCCTAAGTACTCGAGTACTTAGGGCATGATGTATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172365.1-168s1c1
Sequence:CCGGGTTGGGATTACGATTAGGGATCTCGAGATCCCTAATCGTAATCCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172365.1-853s1c1
Sequence:CCGGCGTCAACACTTGACAGAGATTCTCGAGAATCTCTGTCAAGTGTTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172365.1-567s1c1
Sequence:CCGGGTACTACTTATCCCATTACTTCTCGAGAAGTAATGGGATAAGTAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172365.1-555s1c1
Sequence:CCGGCATGGCATTATTGTACTACTTCTCGAGAAGTAGTACAATAATGCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172365
PPP1R36 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 36
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-414s21c1
Sequence:CCGGTGTAGAGAAACGAGGTCAACACTCGAGTGTTGACCTCGTTTCTCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-1105s21c1
Sequence:CCGGCATCAAGTAGACGTCAGATTCCTCGAGGAATCTGACGTCTACTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-441s21c1
Sequence:CCGGCATTACACTGGATGATGTTAACTCGAGTTAACATCATCCAGTGTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-890s21c1
Sequence:CCGGGACTCTTTCGTACCAATATGTCTCGAGACATATTGGTACGAAAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-517s21c1
Sequence:CCGGACAACATTTATGAGGAATAAGCTCGAGCTTATTCCTCATAAATGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172365.1-1344s21c1
Sequence:CCGGTCATACATCATGCCCTAAGTACTCGAGTACTTAGGGCATGATGTATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172365.1-168s1c1
Sequence:CCGGGTTGGGATTACGATTAGGGATCTCGAGATCCCTAATCGTAATCCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172365.1-853s1c1
Sequence:CCGGCGTCAACACTTGACAGAGATTCTCGAGAATCTCTGTCAAGTGTTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172365.1-567s1c1
Sequence:CCGGGTACTACTTATCCCATTACTTCTCGAGAAGTAATGGGATAAGTAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172365.1-555s1c1
Sequence:CCGGCATGGCATTATTGTACTACTTCTCGAGAAGTAGTACAATAATGCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163103
PPP1R36 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 36
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000346662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163103.1-1246s21c1
Sequence:CCGGGCCAAGCACCTGCCCTAAATACTCGAGTATTTAGGGCAGGTGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163103.1-1032s21c1
Sequence:CCGGCCCGAGAGGAGAACATAATAACTCGAGTTATTATGTTCTCCTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163103.1-1104s21c1
Sequence:CCGGGAAATCTGTTCAACCCGAATACTCGAGTATTCGGGTTGAACAGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163103
PPP1R36 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 36
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000346662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163103.1-1246s21c1
Sequence:CCGGGCCAAGCACCTGCCCTAAATACTCGAGTATTTAGGGCAGGTGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163103.1-1032s21c1
Sequence:CCGGCCCGAGAGGAGAACATAATAACTCGAGTTATTATGTTCTCCTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163103.1-1104s21c1
Sequence:CCGGGAAATCTGTTCAACCCGAATACTCGAGTATTCGGGTTGAACAGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163103
PPP1R36 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 36
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000346662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163103.1-1246s21c1
Sequence:CCGGGCCAAGCACCTGCCCTAAATACTCGAGTATTTAGGGCAGGTGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163103.1-1032s21c1
Sequence:CCGGCCCGAGAGGAGAACATAATAACTCGAGTTATTATGTTCTCCTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163103.1-1104s21c1
Sequence:CCGGGAAATCTGTTCAACCCGAATACTCGAGTATTCGGGTTGAACAGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)