EMAIL THIS PAGE TO A FRIEND

PPP1R3A

protein phosphatase 1, regulatory subunit 3A

147 Gene Product Result for
Synonyms: GM PP1G PPP1R3
Gene ID:
Human(5506) Summary: The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
Mouse(140491) protein phosphatase 1, regulatory (inhibitor) subunit 3A
Rat(500036) protein phosphatase 1, regulatory subunit 3A
cow(784877) protein phosphatase 1, regulatory subunit 3A
sheep(101110321) protein phosphatase 1, regulatory subunit 3A
naked mole-rat(101699914) protein phosphatase 1, regulatory subunit 3A
domestic guinea pig(100717021) protein phosphatase 1, regulatory subunit 3A
chicken(427858) protein phosphatase 1, regulatory subunit 3A
Horse(100055851) protein phosphatase 1, regulatory subunit 3A
dog(482411) protein phosphatase 1, regulatory subunit 3A
chicken(101747406) protein phosphatase 1, regulatory subunit 3A
domestic cat(101084864) protein phosphatase 1, regulatory subunit 3A
chicken(101665859) protein phosphatase 1, regulatory subunit 3A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002711 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073761 MISSION® esiRNA esiRNA human PPP1R3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002711 Rosetta Predictions human pricing
NM_001109222 Rosetta Predictions rat pricing
NM_080464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334294 predicted 2440
2 SASI_Hs01_00228552 predicted 1717
3 SASI_Hs02_00334295 predicted 2669
4 SASI_Hs01_00228553 predicted 2818
5 SASI_Hs01_00228560 predicted 1352
6 SASI_Hs01_00228557 predicted 438
7 SASI_Hs01_00228559 predicted 3177
8 SASI_Hs02_00334296 predicted 1754
9 SASI_Hs02_00334297 predicted 2456
10 SASI_Hs02_00334298 predicted 867
11 SASI_Hs01_00228554 predicted 3426
12 SASI_Hs01_00228555 predicted 2728
13 SASI_Hs01_00228556 predicted 2901
14 SASI_Hs01_00228558 predicted 1473
15 SASI_Hs01_00228561 predicted 2959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246284 predicted 1350
2 SASI_Rn02_00246285 predicted 964
3 SASI_Rn02_00246286 predicted 496
4 SASI_Rn02_00246287 predicted 2626
5 SASI_Rn02_00246288 predicted 3249
6 SASI_Rn02_00246289 predicted 2519
7 SASI_Rn02_00246290 predicted 315
8 SASI_Rn02_00246291 predicted 592
9 SASI_Rn02_00246292 predicted 2438
10 SASI_Rn02_00246293 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050063 predicted 2012
2 SASI_Mm01_00050064 predicted 1644
3 SASI_Mm01_00050065 predicted 1692
4 SASI_Mm01_00050066 predicted 3189
5 SASI_Mm01_00050067 predicted 2465
6 SASI_Mm01_00050068 predicted 2151
7 SASI_Mm01_00050070 predicted 2479
8 SASI_Mm01_00050071 predicted 1658
9 SASI_Mm02_00338133 predicted 2455
10 SASI_Mm01_00050072 predicted 993
11 SASI_Mm01_00050069 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002711
PPP1R3A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002711.2-1491s1c1
Sequence:CCGGCGTCGGCATGTCTCAAAGAATCTCGAGATTCTTTGAGACATGCCGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002711.2-3388s1c1
Sequence:CCGGGCACTACTATTCTCTCTTAAACTCGAGTTTAAGAGAGAATAGTAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002711.3-448s21c1
Sequence:CCGGTACAAGTATCAAGGGTATTATCTCGAGATAATACCCTTGATACTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002711.2-842s1c1
Sequence:CCGGCCAAAGAATACAGATACCTATCTCGAGATAGGTATCTGTATTCTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002711.2-2841s1c1
Sequence:CCGGGCCAACCTATTTCTACGAAATCTCGAGATTTCGTAGAAATAGGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002711.2-2918s1c1
Sequence:CCGGCCTGAGTCTAAACCTGAAGAACTCGAGTTCTTCAGGTTTAGACTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002711.3-2398s21c1
Sequence:CCGGACGAGATACAGTAGGTGTAATCTCGAGATTACACCTACTGTATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002711.3-876s21c1
Sequence:CCGGCCTATATCCCAACAATCATTTCTCGAGAAATGATTGTTGGGATATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002711
PPP1R3A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002711.2-1491s1c1
Sequence:CCGGCGTCGGCATGTCTCAAAGAATCTCGAGATTCTTTGAGACATGCCGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002711.2-3388s1c1
Sequence:CCGGGCACTACTATTCTCTCTTAAACTCGAGTTTAAGAGAGAATAGTAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002711.3-448s21c1
Sequence:CCGGTACAAGTATCAAGGGTATTATCTCGAGATAATACCCTTGATACTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002711.2-842s1c1
Sequence:CCGGCCAAAGAATACAGATACCTATCTCGAGATAGGTATCTGTATTCTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002711.2-2841s1c1
Sequence:CCGGGCCAACCTATTTCTACGAAATCTCGAGATTTCGTAGAAATAGGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002711.2-2918s1c1
Sequence:CCGGCCTGAGTCTAAACCTGAAGAACTCGAGTTCTTCAGGTTTAGACTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002711.3-2398s21c1
Sequence:CCGGACGAGATACAGTAGGTGTAATCTCGAGATTACACCTACTGTATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002711.3-876s21c1
Sequence:CCGGCCTATATCCCAACAATCATTTCTCGAGAAATGATTGTTGGGATATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002711
PPP1R3A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002711.2-1491s1c1
Sequence:CCGGCGTCGGCATGTCTCAAAGAATCTCGAGATTCTTTGAGACATGCCGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002711.2-3388s1c1
Sequence:CCGGGCACTACTATTCTCTCTTAAACTCGAGTTTAAGAGAGAATAGTAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002711.3-448s21c1
Sequence:CCGGTACAAGTATCAAGGGTATTATCTCGAGATAATACCCTTGATACTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002711.2-842s1c1
Sequence:CCGGCCAAAGAATACAGATACCTATCTCGAGATAGGTATCTGTATTCTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002711.2-2841s1c1
Sequence:CCGGGCCAACCTATTTCTACGAAATCTCGAGATTTCGTAGAAATAGGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002711.2-2918s1c1
Sequence:CCGGCCTGAGTCTAAACCTGAAGAACTCGAGTTCTTCAGGTTTAGACTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002711.3-2398s21c1
Sequence:CCGGACGAGATACAGTAGGTGTAATCTCGAGATTACACCTACTGTATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002711.3-876s21c1
Sequence:CCGGCCTATATCCCAACAATCATTTCTCGAGAAATGATTGTTGGGATATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080464
PPP1R3A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080464.1-2308s1c1
Sequence:CCGGGCAGGTGTAATCCATGACAATCTCGAGATTGTCATGGATTACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080464.1-3243s1c1
Sequence:CCGGGCAAAGAGAGTCTGTTAAGAACTCGAGTTCTTAACAGACTCTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080464.1-224s1c1
Sequence:CCGGGCCTTGTGTCTGTTAAAGAATCTCGAGATTCTTTAACAGACACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080464.1-1352s1c1
Sequence:CCGGCCTTCGATCAAAGAATGGCATCTCGAGATGCCATTCTTTGATCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080464.1-5372s1c1
Sequence:CCGGCCTCTATTTGATTTCTGGTAACTCGAGTTACCAGAAATCAAATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080464
PPP1R3A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080464.1-2308s1c1
Sequence:CCGGGCAGGTGTAATCCATGACAATCTCGAGATTGTCATGGATTACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080464.1-3243s1c1
Sequence:CCGGGCAAAGAGAGTCTGTTAAGAACTCGAGTTCTTAACAGACTCTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080464.1-224s1c1
Sequence:CCGGGCCTTGTGTCTGTTAAAGAATCTCGAGATTCTTTAACAGACACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080464.1-1352s1c1
Sequence:CCGGCCTTCGATCAAAGAATGGCATCTCGAGATGCCATTCTTTGATCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080464.1-5372s1c1
Sequence:CCGGCCTCTATTTGATTTCTGGTAACTCGAGTTACCAGAAATCAAATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080464
PPP1R3A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080464.1-2308s1c1
Sequence:CCGGGCAGGTGTAATCCATGACAATCTCGAGATTGTCATGGATTACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080464.1-3243s1c1
Sequence:CCGGGCAAAGAGAGTCTGTTAAGAACTCGAGTTCTTAACAGACTCTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080464.1-224s1c1
Sequence:CCGGGCCTTGTGTCTGTTAAAGAATCTCGAGATTCTTTAACAGACACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080464.1-1352s1c1
Sequence:CCGGCCTTCGATCAAAGAATGGCATCTCGAGATGCCATTCTTTGATCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080464.1-5372s1c1
Sequence:CCGGCCTCTATTTGATTTCTGGTAACTCGAGTTACCAGAAATCAAATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)