EMAIL THIS PAGE TO A FRIEND

PPP1R3B

protein phosphatase 1, regulatory subunit 3B

76 Gene Product Result for
Synonyms: GL PPP1R4 PTG
UniProtKB ID: Q86XI6, B3KTV3, Q9H812
Gene ID:
Human(79660) Summary: This gene encodes the catalytic subunit of the serine/theonine phosphatase, protein phosphatase-1. The encoded protein is expressed in liver and skeletal muscle tissue and may be involved in regulating glycogen synthesis in these tissues. This gene may be a involved in type 2 diabetes and maturity-onset diabetes of the young. Alternate splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Jan 2011]
Mouse(244416) protein phosphatase 1, regulatory (inhibitor) subunit 3B
Rat(192280) protein phosphatase 1, regulatory subunit 3B
Zebrafish(327285) protein phosphatase 1, regulatory (inhibitor) subunit 3B
chicken(422630) protein phosphatase 1, regulatory subunit 3B
domestic cat(101088570) protein phosphatase 1, regulatory subunit 3B
dog(482881) protein phosphatase 1, regulatory subunit 3B
domestic guinea pig(100728853) protein phosphatase 1, regulatory subunit 3B
cow(514428) protein phosphatase 1, regulatory subunit 3B
Goat(100861092) protein phosphatase 1, regulatory subunit 3B
sheep(101102871) protein phosphatase 1, regulatory subunit 3B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024607 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024607 Rosetta Predictions human pricing
NM_138912 Rosetta Predictions rat pricing
NM_177741 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078218 predicted 375
2 SASI_Hs01_00078219 predicted 850
3 SASI_Hs01_00078220 predicted 401
4 SASI_Hs01_00078221 predicted 623
5 SASI_Hs01_00078222 predicted 388
6 SASI_Hs02_00356970 predicted 561
7 SASI_Hs01_00078224 predicted 417
8 SASI_Hs02_00356971 predicted 741
9 SASI_Hs01_00078225 predicted 974
10 SASI_Hs01_00078226 predicted 527
11 SASI_Hs01_00078223 predicted 897
12 SASI_Hs01_00078227 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119016 predicted 956
2 SASI_Rn01_00119018 predicted 1075
3 SASI_Rn01_00119019 predicted 595
4 SASI_Rn01_00119020 predicted 329
5 SASI_Rn02_00268392 predicted 1105
6 SASI_Rn01_00119021 predicted 1147
7 SASI_Rn01_00119022 predicted 1068
8 SASI_Rn01_00119023 predicted 488
9 SASI_Rn01_00119024 predicted 1085
10 SASI_Rn01_00119025 predicted 947
11 SASI_Rn01_00119017 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077648 predicted 331
2 SASI_Mm01_00077649 predicted 302
3 SASI_Mm01_00077650 predicted 599
4 SASI_Mm01_00077651 predicted 455
5 SASI_Mm01_00077652 predicted 439
6 SASI_Mm01_00077653 predicted 309
7 SASI_Mm01_00077654 predicted 336
8 SASI_Mm02_00348112 predicted 668
9 SASI_Mm01_00077655 predicted 999
10 SASI_Mm01_00077656 predicted 822
11 SASI_Mm01_00077657 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177741
PPP1R3B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177741.3-1380s21c1
Sequence:CCGGACACACTGGCCTGATTGATACCTCGAGGTATCAATCAGGCCAGTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177741.3-1273s21c1
Sequence:CCGGCAATCTCCAGCCTTACCATTGCTCGAGCAATGGTAAGGCTGGAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177741.3-716s21c1
Sequence:CCGGTTGCCGTGTGCTACGAGTGTACTCGAGTACACTCGTAGCACACGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177741.2-681s1c1
Sequence:CCGGGACATCAGCTTACCCGAGAAACTCGAGTTTCTCGGGTAAGCTGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177741.2-313s1c1
Sequence:CCGGCCCTGACAATGGTGAAAGTGTCTCGAGACACTTTCACCATTGTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177741.2-2593s1c1
Sequence:CCGGGCTGATTATCTGTGAGGAAATCTCGAGATTTCCTCACAGATAATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177741.2-451s1c1
Sequence:CCGGCCGCAGATTACTTAGACTTCACTCGAGTGAAGTCTAAGTAATCTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177741.3-605s21c1
Sequence:CCGGCAGATTTCCCTTGTCAGTATGCTCGAGCATACTGACAAGGGAAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177741.3-961s21c1
Sequence:CCGGGTCCGTGGCTCAGATCAAGATCTCGAGATCTTGATCTGAGCCACGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177741
PPP1R3B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177741.3-1380s21c1
Sequence:CCGGACACACTGGCCTGATTGATACCTCGAGGTATCAATCAGGCCAGTGTGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000437749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177741.3-1273s21c1
Sequence:CCGGCAATCTCCAGCCTTACCATTGCTCGAGCAATGGTAAGGCTGGAGATTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000421805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177741.3-716s21c1
Sequence:CCGGTTGCCGTGTGCTACGAGTGTACTCGAGTACACTCGTAGCACACGGCAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000184668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177741.2-681s1c1
Sequence:CCGGGACATCAGCTTACCCGAGAAACTCGAGTTTCTCGGGTAAGCTGATGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177741.2-313s1c1
Sequence:CCGGCCCTGACAATGGTGAAAGTGTCTCGAGACACTTTCACCATTGTCAGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000179146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177741.2-2593s1c1
Sequence:CCGGGCTGATTATCTGTGAGGAAATCTCGAGATTTCCTCACAGATAATCAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000181144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177741.2-451s1c1
Sequence:CCGGCCGCAGATTACTTAGACTTCACTCGAGTGAAGTCTAAGTAATCTGCGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000421188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177741.3-605s21c1
Sequence:CCGGCAGATTTCCCTTGTCAGTATGCTCGAGCATACTGACAAGGGAAATCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000416595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177741.3-961s21c1
Sequence:CCGGGTCCGTGGCTCAGATCAAGATCTCGAGATCTTGATCTGAGCCACGGACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177741
PPP1R3B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177741.3-1380s21c1
Sequence:CCGGACACACTGGCCTGATTGATACCTCGAGGTATCAATCAGGCCAGTGTGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177741.3-1273s21c1
Sequence:CCGGCAATCTCCAGCCTTACCATTGCTCGAGCAATGGTAAGGCTGGAGATTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000421805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177741.3-716s21c1
Sequence:CCGGTTGCCGTGTGCTACGAGTGTACTCGAGTACACTCGTAGCACACGGCAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000184668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177741.2-681s1c1
Sequence:CCGGGACATCAGCTTACCCGAGAAACTCGAGTTTCTCGGGTAAGCTGATGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000195956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177741.2-313s1c1
Sequence:CCGGCCCTGACAATGGTGAAAGTGTCTCGAGACACTTTCACCATTGTCAGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000179146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177741.2-2593s1c1
Sequence:CCGGGCTGATTATCTGTGAGGAAATCTCGAGATTTCCTCACAGATAATCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177741.2-451s1c1
Sequence:CCGGCCGCAGATTACTTAGACTTCACTCGAGTGAAGTCTAAGTAATCTGCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000421188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177741.3-605s21c1
Sequence:CCGGCAGATTTCCCTTGTCAGTATGCTCGAGCATACTGACAAGGGAAATCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177741.3-961s21c1
Sequence:CCGGGTCCGTGGCTCAGATCAAGATCTCGAGATCTTGATCTGAGCCACGGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024607
VALIDATED
PPP1R3B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-760s21c1
Sequence:CCGGCCCGAGAAGATTCAGTCTTATCTCGAGATAAGACTGAATCTTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-697s21c1
Sequence:CCGGCAGTACGTGAAGGACACTTATCTCGAGATAAGTGTCCTTCACGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-614s21c1
Sequence:CCGGAGGTTCAGAACCTCGCATTTGCTCGAGCAAATGCGAGGTTCTGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-443s21c1
Sequence:CCGGCCGAGCTCCTAGACAACATTGCTCGAGCAATGTTGTCTAGGAGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-512s21c1
Sequence:CCGGAGCCCTCTGCAGATTACTTAGCTCGAGCTAAGTAATCTGCAGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-408s21c1
Sequence:CCGGATTCGATGACCCGCTAGATATCTCGAGATATCTAGCGGGTCATCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-909s21c1
Sequence:CCGGTGGACCGGATTTGGGAATATCCTCGAGGATATTCCCAAATCCGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024607.x-3221s1c1
Sequence:CCGGGTACATAACCAACAGGCAGATCTCGAGATCTGCCTGTTGGTTATGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024607.x-506s1c1
Sequence:CCGGGCAGATTACTTAGACTTTAGACTCGAGTCTAAAGTCTAAGTAATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024607.x-613s1c1
Sequence:CCGGCGCATTTGAGAAGACCGTGAACTCGAGTTCACGGTCTTCTCAAATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-858s21c1
Sequence:CCGGGATCATCCGGGCTGAGTTAAACTCGAGTTTAACTCAGCCCGGATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024607.x-723s1c1
Sequence:CCGGCGTTCTCCTTCGACATCAGTTCTCGAGAACTGATGTCGAAGGAGAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024607.x-938s1c1
Sequence:CCGGCGGTGTTCCTATGGTCTGTTTCTCGAGAAACAGACCATAGGAACACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024607
VALIDATED
PPP1R3B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-760s21c1
Sequence:CCGGCCCGAGAAGATTCAGTCTTATCTCGAGATAAGACTGAATCTTCTCGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-697s21c1
Sequence:CCGGCAGTACGTGAAGGACACTTATCTCGAGATAAGTGTCCTTCACGTACTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-614s21c1
Sequence:CCGGAGGTTCAGAACCTCGCATTTGCTCGAGCAAATGCGAGGTTCTGAACCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-443s21c1
Sequence:CCGGCCGAGCTCCTAGACAACATTGCTCGAGCAATGTTGTCTAGGAGCTCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-512s21c1
Sequence:CCGGAGCCCTCTGCAGATTACTTAGCTCGAGCTAAGTAATCTGCAGAGGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-408s21c1
Sequence:CCGGATTCGATGACCCGCTAGATATCTCGAGATATCTAGCGGGTCATCGAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-909s21c1
Sequence:CCGGTGGACCGGATTTGGGAATATCCTCGAGGATATTCCCAAATCCGGTCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024607.x-3221s1c1
Sequence:CCGGGTACATAACCAACAGGCAGATCTCGAGATCTGCCTGTTGGTTATGTACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024607.x-506s1c1
Sequence:CCGGGCAGATTACTTAGACTTTAGACTCGAGTCTAAAGTCTAAGTAATCTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024607.x-613s1c1
Sequence:CCGGCGCATTTGAGAAGACCGTGAACTCGAGTTCACGGTCTTCTCAAATGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-858s21c1
Sequence:CCGGGATCATCCGGGCTGAGTTAAACTCGAGTTTAACTCAGCCCGGATGATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024607.x-723s1c1
Sequence:CCGGCGTTCTCCTTCGACATCAGTTCTCGAGAACTGATGTCGAAGGAGAACGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024607.x-938s1c1
Sequence:CCGGCGGTGTTCCTATGGTCTGTTTCTCGAGAAACAGACCATAGGAACACCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024607
VALIDATED
PPP1R3B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-760s21c1
Sequence:CCGGCCCGAGAAGATTCAGTCTTATCTCGAGATAAGACTGAATCTTCTCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-697s21c1
Sequence:CCGGCAGTACGTGAAGGACACTTATCTCGAGATAAGTGTCCTTCACGTACTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-614s21c1
Sequence:CCGGAGGTTCAGAACCTCGCATTTGCTCGAGCAAATGCGAGGTTCTGAACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-443s21c1
Sequence:CCGGCCGAGCTCCTAGACAACATTGCTCGAGCAATGTTGTCTAGGAGCTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-512s21c1
Sequence:CCGGAGCCCTCTGCAGATTACTTAGCTCGAGCTAAGTAATCTGCAGAGGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-408s21c1
Sequence:CCGGATTCGATGACCCGCTAGATATCTCGAGATATCTAGCGGGTCATCGAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-909s21c1
Sequence:CCGGTGGACCGGATTTGGGAATATCCTCGAGGATATTCCCAAATCCGGTCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024607.x-3221s1c1
Sequence:CCGGGTACATAACCAACAGGCAGATCTCGAGATCTGCCTGTTGGTTATGTACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024607.x-506s1c1
Sequence:CCGGGCAGATTACTTAGACTTTAGACTCGAGTCTAAAGTCTAAGTAATCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024607.x-613s1c1
Sequence:CCGGCGCATTTGAGAAGACCGTGAACTCGAGTTCACGGTCTTCTCAAATGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024607.2-858s21c1
Sequence:CCGGGATCATCCGGGCTGAGTTAAACTCGAGTTTAACTCAGCCCGGATGATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024607.x-723s1c1
Sequence:CCGGCGTTCTCCTTCGACATCAGTTCTCGAGAACTGATGTCGAAGGAGAACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024607.x-938s1c1
Sequence:CCGGCGGTGTTCCTATGGTCTGTTTCTCGAGAAACAGACCATAGGAACACCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???