EMAIL THIS PAGE TO A FRIEND

PPP1R3D

protein phosphatase 1, regulatory subunit 3D

54 Gene Product Result for
Synonyms: PPP1R6
UniProtKB ID: O95685, Q6DK02
Gene ID:
Human(5509) Summary: Phosphorylation of serine and threonine residues in proteins is a crucial step in the regulation of many cellular functions ranging from hormonal regulation to cell division and even short-term memory. The level of phosphorylation is controlled by the opposing actions of protein kinases and protein phosphatases. Protein phosphatase 1 (PP1) is 1 of 4 major serine/threonine-specific protein phosphatases which have been identified in eukaryotic cells. PP1 associates with various regulatory subunits that dictate its subcellular localization and modulate its substrate specificity. Several subunits that target PP1 to glycogen have been identified. This gene encodes a glycogen-targeting subunit of PP1. [provided by RefSeq, Jul 2008]
Mouse(228966) protein phosphatase 1, regulatory subunit 3D
Rat(689995) protein phosphatase 1, regulatory subunit 3D
chicken(419220) protein phosphatase 1, regulatory subunit 3D
domestic cat(101086715) protein phosphatase 1, regulatory subunit 3D
dog(485953) protein phosphatase 1, regulatory subunit 3D
naked mole-rat(101727411) protein phosphatase 1, regulatory subunit 3D
domestic guinea pig(100721027) protein phosphatase 1, regulatory subunit 3D
cow(782160) protein phosphatase 1, regulatory subunit 3D
sheep(101113779) protein phosphatase 1, regulatory subunit 3D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006242 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085501 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085501 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085501 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006242 Rosetta Predictions human pricing
NM_001109564 Rosetta Predictions rat pricing
NM_001085501 Rosetta Predictions mouse pricing
XM_141580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174269 predicted 1333
2 SASI_Hs01_00174270 predicted 1298
3 SASI_Hs01_00174271 predicted 1365
4 SASI_Hs01_00174272 predicted 1438
5 SASI_Hs01_00174273 predicted 1436
6 SASI_Hs01_00174274 predicted 1474
7 SASI_Hs01_00174275 predicted 1362
8 SASI_Hs01_00174276 predicted 1478
9 SASI_Hs01_00174277 predicted 1358
10 SASI_Hs01_00174278 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249631 predicted 1496
2 SASI_Rn02_00249632 predicted 978
3 SASI_Rn02_00249633 predicted 1455
4 SASI_Rn02_00249634 predicted 995
5 SASI_Rn02_00249635 predicted 888
6 SASI_Rn02_00249636 predicted 1406
7 SASI_Rn02_00249637 predicted 1339
8 SASI_Rn02_00249638 predicted 781
9 SASI_Rn02_00249639 predicted 1467
10 SASI_Rn02_00249640 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300592 predicted 1525
2 SASI_Mm02_00300593 predicted 1527
3 SASI_Mm02_00300594 predicted 866
4 SASI_Mm02_00300595 predicted 1078
5 SASI_Mm02_00300596 predicted 1007
6 SASI_Mm02_00300597 predicted 608
7 SASI_Mm02_00300598 predicted 1031
8 SASI_Mm02_00300599 predicted 1037
9 SASI_Mm02_00300600 predicted 676
10 SASI_Mm02_00300601 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_141580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224307 predicted 1577
2 SASI_Mm01_00224308 predicted 1579
3 SASI_Mm01_00224309 predicted 920
4 SASI_Mm01_00224310 predicted 1133
5 SASI_Mm01_00224311 predicted 1059
6 SASI_Mm01_00224312 predicted 664
7 SASI_Mm01_00224313 predicted 1076
8 SASI_Mm01_00224314 predicted 1097
9 SASI_Mm01_00224315 predicted 725
10 SASI_Mm01_00224316 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006242
PPP1R3D MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006242.3-705s21c1
Sequence:CCGGGGCACAGGTCAAGGTGTTCAACTCGAGTTGAACACCTTGACCTGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006242.3-1692s21c1
Sequence:CCGGTCAGGAATATTCTCGATTTAACTCGAGTTAAATCGAGAATATTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006242.3-1369s21c1
Sequence:CCGGCCAAGTCCTCTGACCTAATTTCTCGAGAAATTAGGTCAGAGGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006242.3-1172s21c1
Sequence:CCGGACAACGACCACCGAGACTACACTCGAGTGTAGTCTCGGTGGTCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006242.3-2972s1c1
Sequence:CCGGGCCTTGTTACATTTCCTGCTACTCGAGTAGCAGGAAATGTAACAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006242.3-907s1c1
Sequence:CCGGCGTGTCACTTGCTCGGACCTTCTCGAGAAGGTCCGAGCAAGTGACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006242.3-768s1c1
Sequence:CCGGGCTCGCAATCAACTCGGACCTCTCGAGAGGTCCGAGTTGATTGCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006242.3-945s1c1
Sequence:CCGGGCGCGTGTGCAACGTGGCCTTCTCGAGAAGGCCACGTTGCACACGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006242.3-1242s1c1
Sequence:CCGGAGAGAGCTGGATCCACTTCATCTCGAGATGAAGTGGATCCAGCTCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006242
PPP1R3D MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006242.3-705s21c1
Sequence:CCGGGGCACAGGTCAAGGTGTTCAACTCGAGTTGAACACCTTGACCTGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006242.3-1692s21c1
Sequence:CCGGTCAGGAATATTCTCGATTTAACTCGAGTTAAATCGAGAATATTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006242.3-1369s21c1
Sequence:CCGGCCAAGTCCTCTGACCTAATTTCTCGAGAAATTAGGTCAGAGGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006242.3-1172s21c1
Sequence:CCGGACAACGACCACCGAGACTACACTCGAGTGTAGTCTCGGTGGTCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006242.3-2972s1c1
Sequence:CCGGGCCTTGTTACATTTCCTGCTACTCGAGTAGCAGGAAATGTAACAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006242.3-907s1c1
Sequence:CCGGCGTGTCACTTGCTCGGACCTTCTCGAGAAGGTCCGAGCAAGTGACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006242.3-768s1c1
Sequence:CCGGGCTCGCAATCAACTCGGACCTCTCGAGAGGTCCGAGTTGATTGCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006242.3-945s1c1
Sequence:CCGGGCGCGTGTGCAACGTGGCCTTCTCGAGAAGGCCACGTTGCACACGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006242.3-1242s1c1
Sequence:CCGGAGAGAGCTGGATCCACTTCATCTCGAGATGAAGTGGATCCAGCTCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006242
PPP1R3D MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006242.3-705s21c1
Sequence:CCGGGGCACAGGTCAAGGTGTTCAACTCGAGTTGAACACCTTGACCTGTGCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000378109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006242.3-1692s21c1
Sequence:CCGGTCAGGAATATTCTCGATTTAACTCGAGTTAAATCGAGAATATTCCTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006242.3-1369s21c1
Sequence:CCGGCCAAGTCCTCTGACCTAATTTCTCGAGAAATTAGGTCAGAGGACTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006242.3-1172s21c1
Sequence:CCGGACAACGACCACCGAGACTACACTCGAGTGTAGTCTCGGTGGTCGTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006242.3-2972s1c1
Sequence:CCGGGCCTTGTTACATTTCCTGCTACTCGAGTAGCAGGAAATGTAACAAGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006242.3-907s1c1
Sequence:CCGGCGTGTCACTTGCTCGGACCTTCTCGAGAAGGTCCGAGCAAGTGACACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006242.3-768s1c1
Sequence:CCGGGCTCGCAATCAACTCGGACCTCTCGAGAGGTCCGAGTTGATTGCGAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006242.3-945s1c1
Sequence:CCGGGCGCGTGTGCAACGTGGCCTTCTCGAGAAGGCCACGTTGCACACGCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006242.3-1242s1c1
Sequence:CCGGAGAGAGCTGGATCCACTTCATCTCGAGATGAAGTGGATCCAGCTCTCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085501
PPP1R3D MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3D
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085501.1-906s21c1
Sequence:CCGGACATCTTCGCCTTCGGCTTTCCTCGAGGAAAGCCGAAGGCGAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085501.1-963s21c1
Sequence:CCGGTACACTTCGCACTGCGCTATGCTCGAGCATAGCGCAGTGCGAAGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085501.1-1207s21c1
Sequence:CCGGCCTAGTGGTCTGGCCTAATTTCTCGAGAAATTAGGCCAGACCACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085501.1-1011s21c1
Sequence:CCGGACAATGATGGTCGCGACTATACTCGAGTATAGTCGCGACCATCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085501
PPP1R3D MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3D
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085501.1-906s21c1
Sequence:CCGGACATCTTCGCCTTCGGCTTTCCTCGAGGAAAGCCGAAGGCGAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085501.1-963s21c1
Sequence:CCGGTACACTTCGCACTGCGCTATGCTCGAGCATAGCGCAGTGCGAAGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085501.1-1207s21c1
Sequence:CCGGCCTAGTGGTCTGGCCTAATTTCTCGAGAAATTAGGCCAGACCACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085501.1-1011s21c1
Sequence:CCGGACAATGATGGTCGCGACTATACTCGAGTATAGTCGCGACCATCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085501
PPP1R3D MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3D
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085501.1-906s21c1
Sequence:CCGGACATCTTCGCCTTCGGCTTTCCTCGAGGAAAGCCGAAGGCGAAGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000252610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085501.1-963s21c1
Sequence:CCGGTACACTTCGCACTGCGCTATGCTCGAGCATAGCGCAGTGCGAAGTGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000252609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085501.1-1207s21c1
Sequence:CCGGCCTAGTGGTCTGGCCTAATTTCTCGAGAAATTAGGCCAGACCACTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000252608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085501.1-1011s21c1
Sequence:CCGGACAATGATGGTCGCGACTATACTCGAGTATAGTCGCGACCATCATTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???