EMAIL THIS PAGE TO A FRIEND

PPP1R3E

protein phosphatase 1, regulatory subunit 3E

83 Gene Product Result for
UniProtKB ID: Q9H7J1, D3DS47
Gene ID:
Mouse(105651) protein phosphatase 1, regulatory (inhibitor) subunit 3E
Rat(691447) protein phosphatase 1, regulatory subunit 3E
dog(490610) protein phosphatase 1 regulatory subunit 3E-like
cow(527187) protein phosphatase 1, regulatory subunit 3E
domestic guinea pig(100729282) protein phosphatase 1, regulatory subunit 3E
naked mole-rat(101716224) protein phosphatase 1, regulatory subunit 3E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA061600 Anti-PPP1R3E antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_033391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_033391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_033391 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_927029 Rosetta Predictions human pricing
XR_040048 Rosetta Predictions human pricing
XR_040049 Rosetta Predictions human pricing
XR_040050 Rosetta Predictions human pricing
XM_001078311 Rosetta Predictions rat pricing
XM_909597 Rosetta Predictions mouse pricing
XM_993154 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295278 predicted 1257
2 SASI_Hs01_00295279 predicted 1420
3 SASI_Hs01_00295280 predicted 1535
4 SASI_Hs01_00295281 predicted 1531
5 SASI_Hs01_00295282 predicted 1611
6 SASI_Hs01_00295283 predicted 1290
7 SASI_Hs01_00295284 predicted 1452
8 SASI_Hs01_00295285 predicted 1481
9 SASI_Hs01_00295286 predicted 1282
10 SASI_Hs01_00295287 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515460 predicted 5254
2 SASI_Hs02_00515461 predicted 6451
3 SASI_Hs02_00515462 predicted 4785
4 SASI_Hs02_00515463 predicted 1588
5 SASI_Hs02_00515464 predicted 1667
6 SASI_Hs02_00515465 predicted 4577
7 SASI_Hs02_00515466 predicted 1437
8 SASI_Hs02_00515467 predicted 4786
9 SASI_Hs02_00515468 predicted 4786
10 SASI_Hs02_00515469 predicted 6722
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515470 predicted 2013
2 SASI_Hs02_00515471 predicted 3210
3 SASI_Hs02_00515472 predicted 1544
4 SASI_Hs02_00515473 predicted 1459
5 SASI_Hs02_00515474 predicted 442
6 SASI_Hs02_00515475 predicted 1340
7 SASI_Hs02_00515476 predicted 315
8 SASI_Hs02_00515477 predicted 1549
9 SASI_Hs02_00515478 predicted 1551
10 SASI_Hs02_00515479 predicted 3489
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515480 predicted 2049
2 SASI_Hs02_00515481 predicted 3248
3 SASI_Hs02_00515482 predicted 1588
4 SASI_Hs02_00515483 predicted 1496
5 SASI_Hs02_00515484 predicted 482
6 SASI_Hs02_00515485 predicted 1383
7 SASI_Hs02_00515486 predicted 350
8 SASI_Hs02_00515487 predicted 1585
9 SASI_Hs02_00515488 predicted 1587
10 SASI_Hs02_00515489 predicted 3522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360330 predicted 378
2 SASI_Rn02_00360331 predicted 266
3 SASI_Rn02_00360332 predicted 763
4 SASI_Rn02_00360333 predicted 287
5 SASI_Rn02_00360334 predicted 793
6 SASI_Rn02_00360335 predicted 634
7 SASI_Rn02_00360336 predicted 466
8 SASI_Rn02_00360337 predicted 476
9 SASI_Rn02_00360338 predicted 819
10 SASI_Rn02_00360339 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434926 predicted 3703
2 SASI_Mm02_00434927 predicted 3508
3 SASI_Mm02_00434928 predicted 3587
4 SASI_Mm02_00434929 predicted 3608
5 SASI_Mm02_00434930 predicted 3659
6 SASI_Mm02_00434931 predicted 3456
7 SASI_Mm02_00434932 predicted 3476
8 SASI_Mm02_00434933 predicted 2424
9 SASI_Mm02_00434934 predicted 3509
10 SASI_Mm02_00434935 predicted 3338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451291 predicted 2385
2 SASI_Mm02_00451292 predicted 2526
3 SASI_Mm01_00284433 predicted 2437
4 SASI_Mm02_00451293 predicted 2614
5 SASI_Mm02_00451294 predicted 2393
6 SASI_Mm02_00451295 predicted 2640
7 SASI_Mm02_00451296 predicted 2568
8 SASI_Mm02_00451297 predicted 2386
9 SASI_Mm02_00451298 predicted 2468
10 SASI_Mm02_00451299 predicted 2622
11 SASI_Mm01_00284426 predicted 3719
12 SASI_Mm01_00284427 predicted 3531
13 SASI_Mm01_00284428 predicted 3597
14 SASI_Mm01_00284429 predicted 3628
15 SASI_Mm01_00284430 predicted 3480
16 SASI_Mm01_00284431 predicted 3681
17 SASI_Mm01_00284432 predicted 3486
18 SASI_Mm01_00284434 predicted 3521
19 SASI_Mm01_00284435 predicted 3355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_033391
PPP1R3E MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3E
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-992s1c1
Sequence:CCGGCCGTGTGACAGGTCACGAGTTCTCGAGAACTCGTGACCTGTCACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-521s1c1
Sequence:CCGGCACCCGCAAGAGAGTGCGTTTCTCGAGAAACGCACTCTCTTGCGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-737s1c1
Sequence:CCGGCCGCTTGCTGACGCAGCGCATCTCGAGATGCGCTGCGTCAGCAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-1086s1c1
Sequence:CCGGCCGCAGGGCTGGATCCACTTTCTCGAGAAAGTGGATCCAGCCCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-992s1c2
Sequence:CCGGCCGTGTGACAGGTCACGAGTTCTCGAGAACTCGTGACCTGTCACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-737s1c2
Sequence:CCGGCCGCTTGCTGACGCAGCGCATCTCGAGATGCGCTGCGTCAGCAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_033391
PPP1R3E MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3E
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-992s1c1
Sequence:CCGGCCGTGTGACAGGTCACGAGTTCTCGAGAACTCGTGACCTGTCACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-521s1c1
Sequence:CCGGCACCCGCAAGAGAGTGCGTTTCTCGAGAAACGCACTCTCTTGCGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-737s1c1
Sequence:CCGGCCGCTTGCTGACGCAGCGCATCTCGAGATGCGCTGCGTCAGCAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-1086s1c1
Sequence:CCGGCCGCAGGGCTGGATCCACTTTCTCGAGAAAGTGGATCCAGCCCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-992s1c2
Sequence:CCGGCCGTGTGACAGGTCACGAGTTCTCGAGAACTCGTGACCTGTCACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-737s1c2
Sequence:CCGGCCGCTTGCTGACGCAGCGCATCTCGAGATGCGCTGCGTCAGCAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_033391
PPP1R3E MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3E
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-992s1c1
Sequence:CCGGCCGTGTGACAGGTCACGAGTTCTCGAGAACTCGTGACCTGTCACACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-521s1c1
Sequence:CCGGCACCCGCAAGAGAGTGCGTTTCTCGAGAAACGCACTCTCTTGCGGGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-737s1c1
Sequence:CCGGCCGCTTGCTGACGCAGCGCATCTCGAGATGCGCTGCGTCAGCAAGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-1086s1c1
Sequence:CCGGCCGCAGGGCTGGATCCACTTTCTCGAGAAAGTGGATCCAGCCCTGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-992s1c2
Sequence:CCGGCCGTGTGACAGGTCACGAGTTCTCGAGAACTCGTGACCTGTCACACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_033391.10-737s1c2
Sequence:CCGGCCGCTTGCTGACGCAGCGCATCTCGAGATGCGCTGCGTCAGCAAGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???