EMAIL THIS PAGE TO A FRIEND

PPP1R3F

protein phosphatase 1, regulatory subunit 3F

78 Gene Product Result for
Synonyms: HB2E R3F
UniProtKB ID: Q6ZSY5, A2VDJ8, B3KPW2, E9PCM3
Gene ID:
Human(89801) Summary: This gene encodes a protein that has been identified as one of several type-1 protein phosphatase (PP1) regulatory subunits. One or two of these subunits, together with the well-conserved catalytic subunit, can form the PP1 holoenzyme, where the regulatory subunit functions to regulate substrate specificity and/or targeting to a particular cellular compartment. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(54646) protein phosphatase 1, regulatory (inhibitor) subunit 3F
naked mole-rat(101723844) protein phosphatase 1, regulatory subunit 3F
domestic guinea pig(100736074) protein phosphatase 1, regulatory subunit 3F
cow(513859) protein phosphatase 1, regulatory subunit 3F
sheep(101111782) protein phosphatase 1, regulatory subunit 3F
dog(491877) protein phosphatase 1, regulatory subunit 3F
domestic cat(101084601) protein phosphatase 1, regulatory subunit 3F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033215 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_372210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372210 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033215 Rosetta Predictions human pricing
NM_138605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176100 predicted 2388
2 SASI_Hs01_00176101 predicted 2492
3 SASI_Hs01_00176102 predicted 1961
4 SASI_Hs01_00176103 predicted 2424
5 SASI_Hs01_00176104 predicted 1092
6 SASI_Hs01_00176105 predicted 2439
7 SASI_Hs01_00176107 predicted 2475
8 SASI_Hs01_00176108 predicted 2242
9 SASI_Hs02_00361010 predicted 2245
10 SASI_Hs02_00361011 predicted 1955
11 SASI_Hs01_00176106 predicted 1429
12 SASI_Hs01_00176109 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141110 predicted 1003
2 SASI_Mm01_00141111 predicted 1909
3 SASI_Mm01_00141112 predicted 998
4 SASI_Mm01_00141113 predicted 1736
5 SASI_Mm01_00141114 predicted 1592
6 SASI_Mm01_00141115 predicted 901
7 SASI_Mm01_00141116 predicted 1425
8 SASI_Mm01_00141117 predicted 1839
9 SASI_Mm02_00339678 predicted 1647
10 SASI_Mm02_00339679 predicted 673
11 SASI_Mm01_00141118 predicted 1794
12 SASI_Mm01_00141119 predicted 2002
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033215
PPP1R3F MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3F
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033215.3-2759s21c1
Sequence:CCGGGCAACCTGCTGGAGCTTTATTCTCGAGAATAAAGCTCCAGCAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033215.3-1042s21c1
Sequence:CCGGGACGAAGAACATGGATGATAACTCGAGTTATCATCCATGTTCTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033215.3-2719s21c1
Sequence:CCGGCACAATTACCCAGAGATATATCTCGAGATATATCTCTGGGTAATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033215
PPP1R3F MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3F
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033215.3-2759s21c1
Sequence:CCGGGCAACCTGCTGGAGCTTTATTCTCGAGAATAAAGCTCCAGCAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033215.3-1042s21c1
Sequence:CCGGGACGAAGAACATGGATGATAACTCGAGTTATCATCCATGTTCTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033215.3-2719s21c1
Sequence:CCGGCACAATTACCCAGAGATATATCTCGAGATATATCTCTGGGTAATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033215
PPP1R3F MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3F
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000360041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033215.3-2759s21c1
Sequence:CCGGGCAACCTGCTGGAGCTTTATTCTCGAGAATAAAGCTCCAGCAGGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000359982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033215.3-1042s21c1
Sequence:CCGGGACGAAGAACATGGATGATAACTCGAGTTATCATCCATGTTCTTCGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000359983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033215.3-2719s21c1
Sequence:CCGGCACAATTACCCAGAGATATATCTCGAGATATATCTCTGGGTAATTGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138605
VALIDATED
PPP1R3F MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3F
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138605.2-1829s21c1
Sequence:CCGGCTGCACCTGAATAGGGTAATACTCGAGTATTACCCTATTCAGGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138605.2-897s21c1
Sequence:CCGGTGAGGAGTGCGGACGATAATACTCGAGTATTATCGTCCGCACTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138605.2-2176s21c1
Sequence:CCGGTGTACTGGCTGGGCTCGTTATCTCGAGATAACGAGCCCAGCCAGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138605.2-1685s21c1
Sequence:CCGGCGCTCTGTGATAGCTACTATGCTCGAGCATAGTAGCTATCACAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138605.2-2897s21c1
Sequence:CCGGTTTGCCTTGTGGTCCTAATATCTCGAGATATTAGGACCACAAGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138605
VALIDATED
PPP1R3F MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3F
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138605.2-1829s21c1
Sequence:CCGGCTGCACCTGAATAGGGTAATACTCGAGTATTACCCTATTCAGGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138605.2-897s21c1
Sequence:CCGGTGAGGAGTGCGGACGATAATACTCGAGTATTATCGTCCGCACTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138605.2-2176s21c1
Sequence:CCGGTGTACTGGCTGGGCTCGTTATCTCGAGATAACGAGCCCAGCCAGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138605.2-1685s21c1
Sequence:CCGGCGCTCTGTGATAGCTACTATGCTCGAGCATAGTAGCTATCACAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138605.2-2897s21c1
Sequence:CCGGTTTGCCTTGTGGTCCTAATATCTCGAGATATTAGGACCACAAGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138605
VALIDATED
PPP1R3F MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3F
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138605.2-1829s21c1
Sequence:CCGGCTGCACCTGAATAGGGTAATACTCGAGTATTACCCTATTCAGGTGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138605.2-897s21c1
Sequence:CCGGTGAGGAGTGCGGACGATAATACTCGAGTATTATCGTCCGCACTCCTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138605.2-2176s21c1
Sequence:CCGGTGTACTGGCTGGGCTCGTTATCTCGAGATAACGAGCCCAGCCAGTACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138605.2-1685s21c1
Sequence:CCGGCGCTCTGTGATAGCTACTATGCTCGAGCATAGTAGCTATCACAGAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138605.2-2897s21c1
Sequence:CCGGTTTGCCTTGTGGTCCTAATATCTCGAGATATTAGGACCACAAGGCAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372210
PPP1R3F MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3F
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-2215s1c2
Sequence:CCGGCCAAAGAAGTCTCCCACCCTACTCGAGTAGGGTGGGAGACTTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-1127s1c1
Sequence:CCGGCCCAGATGACACTTCAGGTTTCTCGAGAAACCTGAAGTGTCATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-1949s1c1
Sequence:CCGGCCAGCTCTTTGCACATGAATACTCGAGTATTCATGTGCAAAGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-1025s1c1
Sequence:CCGGAGACGAAGAACATGGATGATACTCGAGTATCATCCATGTTCTTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-2137s1c1
Sequence:CCGGGAAGTCTGTCTCTCTAGTGTACTCGAGTACACTAGAGAGACAGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-2215s1c1
Sequence:CCGGCCAAAGAAGTCTCCCACCCTACTCGAGTAGGGTGGGAGACTTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372210
PPP1R3F MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3F
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-2215s1c2
Sequence:CCGGCCAAAGAAGTCTCCCACCCTACTCGAGTAGGGTGGGAGACTTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-1127s1c1
Sequence:CCGGCCCAGATGACACTTCAGGTTTCTCGAGAAACCTGAAGTGTCATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-1949s1c1
Sequence:CCGGCCAGCTCTTTGCACATGAATACTCGAGTATTCATGTGCAAAGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-1025s1c1
Sequence:CCGGAGACGAAGAACATGGATGATACTCGAGTATCATCCATGTTCTTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-2137s1c1
Sequence:CCGGGAAGTCTGTCTCTCTAGTGTACTCGAGTACACTAGAGAGACAGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-2215s1c1
Sequence:CCGGCCAAAGAAGTCTCCCACCCTACTCGAGTAGGGTGGGAGACTTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372210
PPP1R3F MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3F
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-2215s1c2
Sequence:CCGGCCAAAGAAGTCTCCCACCCTACTCGAGTAGGGTGGGAGACTTCTTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-1127s1c1
Sequence:CCGGCCCAGATGACACTTCAGGTTTCTCGAGAAACCTGAAGTGTCATCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-1949s1c1
Sequence:CCGGCCAGCTCTTTGCACATGAATACTCGAGTATTCATGTGCAAAGAGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-1025s1c1
Sequence:CCGGAGACGAAGAACATGGATGATACTCGAGTATCATCCATGTTCTTCGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-2137s1c1
Sequence:CCGGGAAGTCTGTCTCTCTAGTGTACTCGAGTACACTAGAGAGACAGACTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372210.1-2215s1c1
Sequence:CCGGCCAAAGAAGTCTCCCACCCTACTCGAGTAGGGTGGGAGACTTCTTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???