EMAIL THIS PAGE TO A FRIEND

PPP1R3G

protein phosphatase 1, regulatory subunit 3G

83 Gene Product Result for
UniProtKB ID: B7ZBB8
Gene ID:
Mouse(76487) protein phosphatase 1, regulatory (inhibitor) subunit 3G
Rat(291069) protein phosphatase 1, regulatory subunit 3G
domestic guinea pig(100718852) protein phosphatase 1, regulatory subunit 3G
naked mole-rat(101720405) protein phosphatase 1, regulatory subunit 3G
cow(616147) protein phosphatase 1, regulatory subunit 3G
chicken(101668775) protein phosphatase 1, regulatory subunit 3G
chicken(101751402) protein phosphatase 1, regulatory subunit 3G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145115 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230351 MISSION® esiRNA targeting human PPP1R3G human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714573 Rosetta Predictions human pricing
XM_001718372 Rosetta Predictions human pricing
XR_018474 Rosetta Predictions human pricing
XR_007035 Rosetta Predictions rat pricing
XR_008214 Rosetta Predictions rat pricing
XM_127272 Rosetta Predictions mouse pricing
XM_911525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398029 predicted 359
2 SASI_Hs02_00398030 predicted 800
3 SASI_Hs02_00398031 predicted 729
4 SASI_Hs02_00398032 predicted 739
5 SASI_Hs02_00398033 predicted 677
6 SASI_Hs02_00398034 predicted 381
7 SASI_Hs02_00398035 predicted 678
8 SASI_Hs02_00398036 predicted 701
9 SASI_Hs02_00398037 predicted 579
10 SASI_Hs02_00398038 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00423432 predicted 363
2 SASI_Hs02_00423433 predicted 805
3 SASI_Hs02_00423434 predicted 727
4 SASI_Hs02_00423435 predicted 738
5 SASI_Hs02_00423436 predicted 673
6 SASI_Hs02_00423437 predicted 383
7 SASI_Hs02_00423438 predicted 675
8 SASI_Hs02_00423439 predicted 700
9 SASI_Hs02_00423440 predicted 586
10 SASI_Hs02_00423441 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_018474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00496191 predicted 366
2 SASI_Hs02_00496192 predicted 359
3 SASI_Hs02_00496193 predicted 385
4 SASI_Hs02_00496194 predicted 584
5 SASI_Hs02_00496195 predicted 486
6 SASI_Hs02_00496196 predicted 275
7 SASI_Hs02_00496197 predicted 230
8 SASI_Hs02_00496198 predicted 363
9 SASI_Hs02_00496199 predicted 483
10 SASI_Hs02_00496200 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134178 predicted 756
2 SASI_Rn01_00134179 predicted 291
3 SASI_Rn01_00134180 predicted 677
4 SASI_Rn01_00134181 predicted 240
5 SASI_Rn01_00134182 predicted 387
6 SASI_Rn01_00134183 predicted 263
7 SASI_Rn01_00134184 predicted 770
8 SASI_Rn01_00134185 predicted 766
9 SASI_Rn01_00134186 predicted 738
10 SASI_Rn01_00134187 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194596 predicted 763
2 SASI_Rn01_00194597 predicted 290
3 SASI_Rn01_00194598 predicted 680
4 SASI_Rn01_00194599 predicted 239
5 SASI_Rn01_00194600 predicted 393
6 SASI_Rn01_00194601 predicted 259
7 SASI_Rn01_00194602 predicted 774
8 SASI_Rn01_00194603 predicted 760
9 SASI_Rn01_00194604 predicted 734
10 SASI_Rn01_00194605 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424185 predicted 609
2 SASI_Mm01_00212045 predicted 460
3 SASI_Mm02_00424186 predicted 792
4 SASI_Mm02_00424187 predicted 670
5 SASI_Mm02_00424188 predicted 552
6 SASI_Mm01_00212051 predicted 557
7 SASI_Mm02_00424189 predicted 308
8 SASI_Mm02_00424190 predicted 539
9 SASI_Mm02_00424191 predicted 647
10 SASI_Mm02_00424192 predicted 650
11 SASI_Mm01_00212044 predicted 1774
12 SASI_Mm01_00212046 predicted 1515
13 SASI_Mm01_00212047 predicted 1688
14 SASI_Mm01_00212048 predicted 1493
15 SASI_Mm01_00212049 predicted 1574
16 SASI_Mm01_00212050 predicted 1791
17 SASI_Mm01_00212052 predicted 1514
18 SASI_Mm01_00212053 predicted 1757
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436484 predicted 1131
2 SASI_Mm02_00436485 predicted 394
3 SASI_Mm02_00436486 predicted 867
4 SASI_Mm02_00436487 predicted 1116
5 SASI_Mm02_00436488 predicted 1040
6 SASI_Mm02_00436489 predicted 846
7 SASI_Mm02_00436490 predicted 918
8 SASI_Mm02_00436491 predicted 1141
9 SASI_Mm02_00436492 predicted 494
10 SASI_Mm02_00436493 predicted 1103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145115
PPP1R3G MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3G
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1244s21c1
Sequence:GTACCGGCAGACAAGTGAGCGAGCTTAGCTCGAGCTAAGCTCGCTCACTTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1145s21c1
Sequence:GTACCGGAGGAACTTGCTGGGACGCTTTCTCGAGAAAGCGTCCCAGCAAGTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1469s21c1
Sequence:GTACCGGTGTAGCCCTTGCAGTTTGCTGCTCGAGCAGCAAACTGCAAGGGCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145115.1-893s21c1
Sequence:GTACCGGAGTGCTTCCACTTCTCGCTGTCTCGAGACAGCGAGAAGTGGAAGCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1341s21c1
Sequence:GTACCGGTTCCCAGCCTGCGTCAGAATACTCGAGTATTCTGACGCAGGCTGGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145115.1-1076s21c1
Sequence:GTACCGGGAGCCTGGAGAGTTTCGAAGACTCGAGTCTTCGAAACTCTCCAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1109s21c1
Sequence:GTACCGGGGTTGATTAGCACGTGGAGCTCTCGAGAGCTCCACGTGCTAATCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145115
PPP1R3G MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3G
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1244s21c1
Sequence:GTACCGGCAGACAAGTGAGCGAGCTTAGCTCGAGCTAAGCTCGCTCACTTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1145s21c1
Sequence:GTACCGGAGGAACTTGCTGGGACGCTTTCTCGAGAAAGCGTCCCAGCAAGTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1469s21c1
Sequence:GTACCGGTGTAGCCCTTGCAGTTTGCTGCTCGAGCAGCAAACTGCAAGGGCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145115.1-893s21c1
Sequence:GTACCGGAGTGCTTCCACTTCTCGCTGTCTCGAGACAGCGAGAAGTGGAAGCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1341s21c1
Sequence:GTACCGGTTCCCAGCCTGCGTCAGAATACTCGAGTATTCTGACGCAGGCTGGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145115.1-1076s21c1
Sequence:GTACCGGGAGCCTGGAGAGTTTCGAAGACTCGAGTCTTCGAAACTCTCCAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1109s21c1
Sequence:GTACCGGGGTTGATTAGCACGTGGAGCTCTCGAGAGCTCCACGTGCTAATCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145115
PPP1R3G MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3G
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1244s21c1
Sequence:GTACCGGCAGACAAGTGAGCGAGCTTAGCTCGAGCTAAGCTCGCTCACTTGTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1145s21c1
Sequence:GTACCGGAGGAACTTGCTGGGACGCTTTCTCGAGAAAGCGTCCCAGCAAGTTCCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1469s21c1
Sequence:GTACCGGTGTAGCCCTTGCAGTTTGCTGCTCGAGCAGCAAACTGCAAGGGCTACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000382330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145115.1-893s21c1
Sequence:GTACCGGAGTGCTTCCACTTCTCGCTGTCTCGAGACAGCGAGAAGTGGAAGCACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1341s21c1
Sequence:GTACCGGTTCCCAGCCTGCGTCAGAATACTCGAGTATTCTGACGCAGGCTGGGAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145115.1-1076s21c1
Sequence:GTACCGGGAGCCTGGAGAGTTTCGAAGACTCGAGTCTTCGAAACTCTCCAGGCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145115.1-1109s21c1
Sequence:GTACCGGGGTTGATTAGCACGTGGAGCTCTCGAGAGCTCCACGTGCTAATCAACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029628
PPP1R3G MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3G
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029628.1-855s21c1
Sequence:CCGGGACTGCTGCTCCAAGTGTAAGCTCGAGCTTACACTTGGAGCAGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029628.1-1248s21c1
Sequence:CCGGTTCACGGAGTGGCGTACCTTTCTCGAGAAAGGTACGCCACTCCGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029628.1-1519s21c1
Sequence:CCGGCCAACTACACCTTGCGCTATGCTCGAGCATAGCGCAAGGTGTAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029628.1-715s21c1
Sequence:CCGGAGGAGGAGCTACAGGAATATCCTCGAGGATATTCCTGTAGCTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029628.1-1679s21c1
Sequence:CCGGATACACTCTCAGCGCAGATTCCTCGAGGAATCTGCGCTGAGAGTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029628
PPP1R3G MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3G
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029628.1-855s21c1
Sequence:CCGGGACTGCTGCTCCAAGTGTAAGCTCGAGCTTACACTTGGAGCAGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029628.1-1248s21c1
Sequence:CCGGTTCACGGAGTGGCGTACCTTTCTCGAGAAAGGTACGCCACTCCGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029628.1-1519s21c1
Sequence:CCGGCCAACTACACCTTGCGCTATGCTCGAGCATAGCGCAAGGTGTAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029628.1-715s21c1
Sequence:CCGGAGGAGGAGCTACAGGAATATCCTCGAGGATATTCCTGTAGCTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029628.1-1679s21c1
Sequence:CCGGATACACTCTCAGCGCAGATTCCTCGAGGAATCTGCGCTGAGAGTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029628
PPP1R3G MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3G
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029628.1-855s21c1
Sequence:CCGGGACTGCTGCTCCAAGTGTAAGCTCGAGCTTACACTTGGAGCAGCAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000346376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029628.1-1248s21c1
Sequence:CCGGTTCACGGAGTGGCGTACCTTTCTCGAGAAAGGTACGCCACTCCGTGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000346448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029628.1-1519s21c1
Sequence:CCGGCCAACTACACCTTGCGCTATGCTCGAGCATAGCGCAAGGTGTAGTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000346447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029628.1-715s21c1
Sequence:CCGGAGGAGGAGCTACAGGAATATCCTCGAGGATATTCCTGTAGCTCCTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000376383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029628.1-1679s21c1
Sequence:CCGGATACACTCTCAGCGCAGATTCCTCGAGGAATCTGCGCTGAGAGTGTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???