EMAIL THIS PAGE TO A FRIEND

PPP1R7

protein phosphatase 1, regulatory subunit 7

70 Gene Product Result for
Synonyms: SDS22
UniProtKB ID: Q15435, B4DFD4, Q9UQE5, Q9UQE6, Q9Y6K4
Gene ID:
Mouse(66385) protein phosphatase 1, regulatory (inhibitor) subunit 7
Rat(301618) protein phosphatase 1, regulatory subunit 7
domestic guinea pig(100725048) protein phosphatase 1, regulatory subunit 7
naked mole-rat(101712847) protein phosphatase 1, regulatory subunit 7
cow(505297) protein phosphatase 1, regulatory subunit 7
sheep(101102445) protein phosphatase 1, regulatory subunit 7
Zebrafish(560323) protein phosphatase 1, regulatory (inhibitor) subunit 7
chicken(424844) protein phosphatase 1, regulatory (inhibitor) subunit 7
dog(477430) protein phosphatase 1 regulatory subunit 7-like
domestic cat(101090203) protein phosphatase 1, regulatory subunit 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R7781 Anti-PPP1R7 (16-28) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
R7906 Anti-PPP1R7 (296-309) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1406285 Anti-PPP1R7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA034500 Anti-PPP1R7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103124 Anti-PPP1R7 antibody produced in rabbit affinity isolated antibody rat, zebrafish, rabbit, mouse, horse, guinea pig, bovine, human
western blot pricing
HPA034501 Anti-PPP1R7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4502293 Anti-PPP1R7 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB2107183 Anti-PPP1R7 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, human, rat
ELISA, western blot pricing
SAB4100106 Monoclonal Anti-PPP1R7 antibody produced in mouse clone PPP1R7-A87, culture supernatant human
western blot pricing
SAB4100115 Monoclonal Anti-PPP1R7 antibody produced in mouse clone PPP1R7-B87, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002712 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074381 MISSION® esiRNA esiRNA human PPP1R7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002712 siRNAs that have been validated in the lab human pricing
NM_001009825 Rosetta Predictions rat pricing
NM_023200 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002712 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071524 validated 435
1 SASI_Hs01_00071523 validated 787
2 SASI_Hs02_00334299 predicted 889
3 SASI_Hs01_00071525 predicted 981
4 SASI_Hs01_00071526 predicted 376
5 SASI_Hs01_00071528 predicted 1023
6 SASI_Hs01_00071529 predicted 554
7 SASI_Hs01_00071530 predicted 840
8 SASI_Hs01_00071531 predicted 561
9 SASI_Hs01_00071532 predicted 910
10 SASI_Hs01_00071527 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058520 predicted 876
2 SASI_Rn01_00058521 predicted 1190
3 SASI_Rn01_00058522 predicted 474
4 SASI_Rn01_00058523 predicted 837
5 SASI_Rn01_00058524 predicted 489
6 SASI_Rn01_00058525 predicted 252
7 SASI_Rn01_00058526 predicted 895
8 SASI_Rn01_00058527 predicted 845
9 SASI_Rn01_00058528 predicted 431
10 SASI_Rn01_00058529 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326936 predicted 884
2 SASI_Mm02_00326937 predicted 485
3 SASI_Mm02_00326938 predicted 417
4 SASI_Mm02_00326939 predicted 1198
5 SASI_Mm02_00326940 predicted 844
6 SASI_Mm02_00326941 predicted 922
7 SASI_Mm02_00326942 predicted 854
8 SASI_Mm02_00326943 predicted 260
9 SASI_Mm02_00326944 predicted 781
10 SASI_Mm02_00326945 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023200
VALIDATED
PPP1R7 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023200.1-797s1c1
Sequence:CCGGGCAACAATGGTATCGAGGTTACTCGAGTAACCTCGATACCATTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023200.1-2062s1c1
Sequence:CCGGGCCACATATCATGGAAGGTATCTCGAGATACCTTCCATGATATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023200.1-566s1c1
Sequence:CCGGGCAATTTACATCAACTGCAAACTCGAGTTTGCAGTTGATGTAAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023200.1-478s1c1
Sequence:CCGGCTGAGGAACATTGAAGGGATTCTCGAGAATCCCTTCAATGTTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023200.1-798s1c1
Sequence:CCGGCAACAATGGTATCGAGGTTATCTCGAGATAACCTCGATACCATTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023200.2-1174s21c1
Sequence:CCGGGCTCCTGATGTCGTCACTATACTCGAGTATAGTGACGACATCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023200.2-798s21c1
Sequence:CCGGCAACAATGGTATCGAGGTTATCTCGAGATAACCTCGATACCATTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023200.2-478s21c1
Sequence:CCGGCTGAGGAACATTGAAGGGATTCTCGAGAATCCCTTCAATGTTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023200.2-566s21c1
Sequence:CCGGGCAATTTACATCAACTGCAAACTCGAGTTTGCAGTTGATGTAAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023200.2-771s21c1
Sequence:CCGGGGTGAACCTGCGGGAACTATACTCGAGTATAGTTCCCGCAGGTTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023200
VALIDATED
PPP1R7 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023200.1-797s1c1
Sequence:CCGGGCAACAATGGTATCGAGGTTACTCGAGTAACCTCGATACCATTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023200.1-2062s1c1
Sequence:CCGGGCCACATATCATGGAAGGTATCTCGAGATACCTTCCATGATATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023200.1-566s1c1
Sequence:CCGGGCAATTTACATCAACTGCAAACTCGAGTTTGCAGTTGATGTAAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023200.1-478s1c1
Sequence:CCGGCTGAGGAACATTGAAGGGATTCTCGAGAATCCCTTCAATGTTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023200.1-798s1c1
Sequence:CCGGCAACAATGGTATCGAGGTTATCTCGAGATAACCTCGATACCATTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023200.2-1174s21c1
Sequence:CCGGGCTCCTGATGTCGTCACTATACTCGAGTATAGTGACGACATCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023200.2-798s21c1
Sequence:CCGGCAACAATGGTATCGAGGTTATCTCGAGATAACCTCGATACCATTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023200.2-478s21c1
Sequence:CCGGCTGAGGAACATTGAAGGGATTCTCGAGAATCCCTTCAATGTTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023200.2-566s21c1
Sequence:CCGGGCAATTTACATCAACTGCAAACTCGAGTTTGCAGTTGATGTAAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023200.2-771s21c1
Sequence:CCGGGGTGAACCTGCGGGAACTATACTCGAGTATAGTTCCCGCAGGTTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023200
VALIDATED
PPP1R7 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023200.1-797s1c1
Sequence:CCGGGCAACAATGGTATCGAGGTTACTCGAGTAACCTCGATACCATTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023200.1-2062s1c1
Sequence:CCGGGCCACATATCATGGAAGGTATCTCGAGATACCTTCCATGATATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023200.1-566s1c1
Sequence:CCGGGCAATTTACATCAACTGCAAACTCGAGTTTGCAGTTGATGTAAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023200.1-478s1c1
Sequence:CCGGCTGAGGAACATTGAAGGGATTCTCGAGAATCCCTTCAATGTTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023200.1-798s1c1
Sequence:CCGGCAACAATGGTATCGAGGTTATCTCGAGATAACCTCGATACCATTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023200.2-1174s21c1
Sequence:CCGGGCTCCTGATGTCGTCACTATACTCGAGTATAGTGACGACATCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023200.2-798s21c1
Sequence:CCGGCAACAATGGTATCGAGGTTATCTCGAGATAACCTCGATACCATTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023200.2-478s21c1
Sequence:CCGGCTGAGGAACATTGAAGGGATTCTCGAGAATCCCTTCAATGTTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023200.2-566s21c1
Sequence:CCGGGCAATTTACATCAACTGCAAACTCGAGTTTGCAGTTGATGTAAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023200.2-771s21c1
Sequence:CCGGGGTGAACCTGCGGGAACTATACTCGAGTATAGTTCCCGCAGGTTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002712
VALIDATED
PPP1R7 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002712.x-184s1c1
Sequence:CCGGGAGGACCCAGAAGAAGAACATCTCGAGATGTTCTTCTTCTGGGTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002712.x-828s1c1
Sequence:CCGGGAACAATAACAAACTCACGATCTCGAGATCGTGAGTTTGTTATTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002712.x-276s1c1
Sequence:CCGGCATAGGGAAGATTGAAGGATTCTCGAGAATCCTTCAATCTTCCCTATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002712.x-563s1c1
Sequence:CCGGGCAACTTACATCAACTACAGACTCGAGTCTGTAGTTGATGTAAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002712.x-1197s1c1
Sequence:CCGGCAGTCACAAACCCAATGGCAACTCGAGTTGCCATTGGGTTTGTGACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-914s21c1
Sequence:GTACCGGAGTTCTGGATGAACGACAATCCTCGAGGATTGTCGTTCATCCAGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-254s21c1
Sequence:GTACCGGATGTTGATTTGAATCACTATCCTCGAGGATAGTGATTCAAATCAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002712.1-184s21c1
Sequence:CCGGGAGGACCCAGAAGAAGAACATCTCGAGATGTTCTTCTTCTGGGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-407s21c1
Sequence:GTACCGGAGATCAAGAAGATTGAGAATCCTCGAGGATTCTCAATCTTCTTGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-563s21c1
Sequence:CCGGGCAACTTACATCAACTACAGACTCGAGTCTGTAGTTGATGTAAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002712.1-1197s21c1
Sequence:CCGGCAGTCACAAACCCAATGGCAACTCGAGTTGCCATTGGGTTTGTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-378s21c1
Sequence:CCGGTCTTCGAGAGCTGGATCTTTACTCGAGTAAAGATCCAGCTCTCGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002712
VALIDATED
PPP1R7 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002712.x-184s1c1
Sequence:CCGGGAGGACCCAGAAGAAGAACATCTCGAGATGTTCTTCTTCTGGGTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002712.x-828s1c1
Sequence:CCGGGAACAATAACAAACTCACGATCTCGAGATCGTGAGTTTGTTATTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002712.x-276s1c1
Sequence:CCGGCATAGGGAAGATTGAAGGATTCTCGAGAATCCTTCAATCTTCCCTATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002712.x-563s1c1
Sequence:CCGGGCAACTTACATCAACTACAGACTCGAGTCTGTAGTTGATGTAAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002712.x-1197s1c1
Sequence:CCGGCAGTCACAAACCCAATGGCAACTCGAGTTGCCATTGGGTTTGTGACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-914s21c1
Sequence:GTACCGGAGTTCTGGATGAACGACAATCCTCGAGGATTGTCGTTCATCCAGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-254s21c1
Sequence:GTACCGGATGTTGATTTGAATCACTATCCTCGAGGATAGTGATTCAAATCAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002712.1-184s21c1
Sequence:CCGGGAGGACCCAGAAGAAGAACATCTCGAGATGTTCTTCTTCTGGGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-407s21c1
Sequence:GTACCGGAGATCAAGAAGATTGAGAATCCTCGAGGATTCTCAATCTTCTTGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-563s21c1
Sequence:CCGGGCAACTTACATCAACTACAGACTCGAGTCTGTAGTTGATGTAAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002712.1-1197s21c1
Sequence:CCGGCAGTCACAAACCCAATGGCAACTCGAGTTGCCATTGGGTTTGTGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-378s21c1
Sequence:CCGGTCTTCGAGAGCTGGATCTTTACTCGAGTAAAGATCCAGCTCTCGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002712
VALIDATED
PPP1R7 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002712.x-184s1c1
Sequence:CCGGGAGGACCCAGAAGAAGAACATCTCGAGATGTTCTTCTTCTGGGTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002712.x-828s1c1
Sequence:CCGGGAACAATAACAAACTCACGATCTCGAGATCGTGAGTTTGTTATTGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002712.x-276s1c1
Sequence:CCGGCATAGGGAAGATTGAAGGATTCTCGAGAATCCTTCAATCTTCCCTATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002712.x-563s1c1
Sequence:CCGGGCAACTTACATCAACTACAGACTCGAGTCTGTAGTTGATGTAAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002712.x-1197s1c1
Sequence:CCGGCAGTCACAAACCCAATGGCAACTCGAGTTGCCATTGGGTTTGTGACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-914s21c1
Sequence:GTACCGGAGTTCTGGATGAACGACAATCCTCGAGGATTGTCGTTCATCCAGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-254s21c1
Sequence:GTACCGGATGTTGATTTGAATCACTATCCTCGAGGATAGTGATTCAAATCAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002712.1-184s21c1
Sequence:CCGGGAGGACCCAGAAGAAGAACATCTCGAGATGTTCTTCTTCTGGGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-407s21c1
Sequence:GTACCGGAGATCAAGAAGATTGAGAATCCTCGAGGATTCTCAATCTTCTTGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-563s21c1
Sequence:CCGGGCAACTTACATCAACTACAGACTCGAGTCTGTAGTTGATGTAAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002712.1-1197s21c1
Sequence:CCGGCAGTCACAAACCCAATGGCAACTCGAGTTGCCATTGGGTTTGTGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002712.1-378s21c1
Sequence:CCGGTCTTCGAGAGCTGGATCTTTACTCGAGTAAAGATCCAGCTCTCGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)