PPP1R7

protein phosphatase 1, regulatory subunit 7

70 Gene Product Result for

Synonyms: SDS22

Species: Human PPP1R7(5510), Mouse Ppp1r7(66385), Rat Ppp1r7(301618), domestic guinea pig Ppp1r7(100725048), naked mole-rat Ppp1r7(101712847), cow PPP1R7(505297), sheep PPP1R7(101102445), Zebrafish ppp1r7(560323), chicken PPP1R7(424844), dog PPP1R7(477430), domestic cat PPP1R7(101090203)

UniProtKB ID: Q15435, B4DFD4, Q9UQE5, Q9UQE6, Q9Y6K4

Gene ID:

Human(5510)

Mouse(66385) protein phosphatase 1, regulatory (inhibitor) subunit 7

Rat(301618) protein phosphatase 1, regulatory subunit 7

domestic guinea pig(100725048) protein phosphatase 1, regulatory subunit 7

naked mole-rat(101712847) protein phosphatase 1, regulatory subunit 7

cow(505297) protein phosphatase 1, regulatory subunit 7

sheep(101102445) protein phosphatase 1, regulatory subunit 7

Zebrafish(560323) protein phosphatase 1, regulatory (inhibitor) subunit 7

chicken(424844) protein phosphatase 1, regulatory (inhibitor) subunit 7

dog(477430) protein phosphatase 1 regulatory subunit 7-like

domestic cat(101090203) protein phosphatase 1, regulatory subunit 7

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

R7781	Anti-PPP1R7 (16-28) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	human	western blot	pricing

R7906	Anti-PPP1R7 (296-309) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	human	western blot	pricing

SAB1406285	Anti-PPP1R7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	immunofluorescence, western blot	pricing

HPA034500	Anti-PPP1R7 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry, western blot	pricing

SAB2103124	Anti-PPP1R7 antibody produced in rabbit affinity isolated antibody	rat, mouse, guinea pig, horse, human, rabbit	western blot	pricing

HPA034501	Anti-PPP1R7 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry, western blot	pricing

SAB4502293	Anti-PPP1R7 antibody produced in rabbit affinity isolated antibody	human	ELISA, western blot	pricing

SAB2107183	Anti-PPP1R7 antibody produced in rabbit affinity isolated antibody	rabbit, mouse, rat, dog, human, pig	western blot	pricing

SAB4100106	Monoclonal Anti-PPP1R7 antibody produced in mouse clone PPP1R7-A87, culture supernatant	human	western blot	pricing

SAB4100115	Monoclonal Anti-PPP1R7 antibody produced in mouse clone PPP1R7-B87, culture supernatant	human	western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN17284	CompoZr^® Knockout ZFN Kit Human PPP1R7 (NM_002712)	pricing

CKOZFN39184	CompoZr^® Knockout ZFN Kit Mouse Ppp1r7 (NM_023200.2)	pricing

CKOZFN60487	CompoZr^® Knockout ZFN Kit Rat Ppp1r7 (NM_001009825)	pricing

CKOZFND17284	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human PPP1R7 (NM_002712)	pricing

CKOZFND39184	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Ppp1r7 (NM_023200.2)	pricing

CKOZFND60487	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Ppp1r7 (NM_001009825)	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST78994	PrEST Antigen PPP1R7 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

APREST87075	PrEST Antigen PPP1R7 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST27087	SILu^™PrEST PP1R7 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST27088	SILu^™PrEST PP1R7 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_002712	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_002712	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_002712	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_023200	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_023200	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_023200	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU074381	MISSION^® esiRNA esiRNA human PPP1R7 (esiRNA1)	human	pricing

siRNA Nano Scale

Product #	Description	Species	Add to Cart

SIHP0591	MISSION^® Human Phosphatase PPP1R7 siRNA3, Nano Scale 250 pmol	human	pricing

SIHP0589	MISSION^® Human Phosphatase PPP1R7 siRNA1, Nano Scale 250 pmol	human	pricing

SIHP0590	MISSION^® Human Phosphatase PPP1R7 siRNA2, Nano Scale 250 pmol	human	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_002712	siRNAs that have been validated in the lab	human	pricing
NM_001009825	Rosetta Predictions	rat	pricing
NM_023200	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_002712	siRNAs that have been validated in the lab	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00071524 validated	435
1	SASI_Hs01_00071523 validated	787
2	SASI_Hs02_00334299 predicted	889
3	SASI_Hs01_00071525 predicted	981
4	SASI_Hs01_00071526 predicted	376
5	SASI_Hs01_00071528 predicted	1023
6	SASI_Hs01_00071529 predicted	554
7	SASI_Hs01_00071530 predicted	840
8	SASI_Hs01_00071531 predicted	561
9	SASI_Hs01_00071532 predicted	910
10	SASI_Hs01_00071527 predicted	785

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001009825	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00058520 predicted	876
2	SASI_Rn01_00058521 predicted	1190
3	SASI_Rn01_00058522 predicted	474
4	SASI_Rn01_00058523 predicted	837
5	SASI_Rn01_00058524 predicted	489
6	SASI_Rn01_00058525 predicted	252
7	SASI_Rn01_00058526 predicted	895
8	SASI_Rn01_00058527 predicted	845
9	SASI_Rn01_00058528 predicted	431
10	SASI_Rn01_00058529 predicted	246

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_023200	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00326936 predicted	884
2	SASI_Mm02_00326937 predicted	485
3	SASI_Mm02_00326938 predicted	417
4	SASI_Mm02_00326939 predicted	1198
5	SASI_Mm02_00326940 predicted	844
6	SASI_Mm02_00326941 predicted	922
7	SASI_Mm02_00326942 predicted	854
8	SASI_Mm02_00326943 predicted	260
9	SASI_Mm02_00326944 predicted	781
10	SASI_Mm02_00326945 predicted	436

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_002712 VALIDATED	PPP1R7 MISSION shRNA Bacterial Glycerol Stock protein phosphatase 1, regulatory subunit 7	Human

12 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000002467
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002712.x-184s1c1
	Sequence:CCGGGAGGACCCAGAAGAAGAACATCTCGAGATGTTCTTCTTCTGGGTCCTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002468
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.88	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002712.x-1197s1c1
	Sequence:CCGGCAGTCACAAACCCAATGGCAACTCGAGTTGCCATTGGGTTTGTGACTGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002471
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002712.x-276s1c1
	Sequence:CCGGCATAGGGAAGATTGAAGGATTCTCGAGAATCCTTCAATCTTCCCTATGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002470
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002712.x-828s1c1
	Sequence:CCGGGAACAATAACAAACTCACGATCTCGAGATCGTGAGTTTGTTATTGTTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320727
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-563s21c1
	Sequence:CCGGGCAACTTACATCAACTACAGACTCGAGTCTGTAGTTGATGTAAGTTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320649
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_002712.1-1197s21c1
	Sequence:CCGGCAGTCACAAACCCAATGGCAACTCGAGTTGCCATTGGGTTTGTGACTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002469
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002712.x-563s1c1
	Sequence:CCGGGCAACTTACATCAACTACAGACTCGAGTCTGTAGTTGATGTAAGTTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380664
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-407s21c1
	Sequence:GTACCGGAGATCAAGAAGATTGAGAATCCTCGAGGATTCTCAATCTTCTTGATCTTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381508
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-914s21c1
	Sequence:GTACCGGAGTTCTGGATGAACGACAATCCTCGAGGATTGTCGTTCATCCAGAACTTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320726
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_002712.1-184s21c1
	Sequence:CCGGGAGGACCCAGAAGAAGAACATCTCGAGATGTTCTTCTTCTGGGTCCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320729
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-378s21c1
	Sequence:CCGGTCTTCGAGAGCTGGATCTTTACTCGAGTAAAGATCCAGCTCTCGAAGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000379822
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-254s21c1
	Sequence:GTACCGGATGTTGATTTGAATCACTATCCTCGAGGATAGTGATTCAAATCAACATTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_002712 VALIDATED	PPP1R7 MISSION shRNA shRNA Plasmid DNA protein phosphatase 1, regulatory subunit 7	Human

12 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000002467
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002712.x-184s1c1
	Sequence:CCGGGAGGACCCAGAAGAAGAACATCTCGAGATGTTCTTCTTCTGGGTCCTCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002468
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.88	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002712.x-1197s1c1
	Sequence:CCGGCAGTCACAAACCCAATGGCAACTCGAGTTGCCATTGGGTTTGTGACTGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002471
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002712.x-276s1c1
	Sequence:CCGGCATAGGGAAGATTGAAGGATTCTCGAGAATCCTTCAATCTTCCCTATGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002470
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002712.x-828s1c1
	Sequence:CCGGGAACAATAACAAACTCACGATCTCGAGATCGTGAGTTTGTTATTGTTCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320727
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-563s21c1
	Sequence:CCGGGCAACTTACATCAACTACAGACTCGAGTCTGTAGTTGATGTAAGTTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320649
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_002712.1-1197s21c1
	Sequence:CCGGCAGTCACAAACCCAATGGCAACTCGAGTTGCCATTGGGTTTGTGACTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002469
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002712.x-563s1c1
	Sequence:CCGGGCAACTTACATCAACTACAGACTCGAGTCTGTAGTTGATGTAAGTTGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380664
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-407s21c1
	Sequence:GTACCGGAGATCAAGAAGATTGAGAATCCTCGAGGATTCTCAATCTTCTTGATCTTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381508
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-914s21c1
	Sequence:GTACCGGAGTTCTGGATGAACGACAATCCTCGAGGATTGTCGTTCATCCAGAACTTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320726
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_002712.1-184s21c1
	Sequence:CCGGGAGGACCCAGAAGAAGAACATCTCGAGATGTTCTTCTTCTGGGTCCTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320729
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-378s21c1
	Sequence:CCGGTCTTCGAGAGCTGGATCTTTACTCGAGTAAAGATCCAGCTCTCGAAGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000379822
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-254s21c1
	Sequence:GTACCGGATGTTGATTTGAATCACTATCCTCGAGGATAGTGATTCAAATCAACATTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_002712 VALIDATED	PPP1R7 MISSION shRNA Lentiviral Transduction Particles protein phosphatase 1, regulatory subunit 7	Human

12 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000002467
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002712.x-184s1c1
	Sequence:CCGGGAGGACCCAGAAGAAGAACATCTCGAGATGTTCTTCTTCTGGGTCCTCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002468
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.88	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002712.x-1197s1c1
	Sequence:CCGGCAGTCACAAACCCAATGGCAACTCGAGTTGCCATTGGGTTTGTGACTGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002471
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002712.x-276s1c1
	Sequence:CCGGCATAGGGAAGATTGAAGGATTCTCGAGAATCCTTCAATCTTCCCTATGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002470
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_002712.x-828s1c1
	Sequence:CCGGGAACAATAACAAACTCACGATCTCGAGATCGTGAGTTTGTTATTGTTCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320727
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-563s21c1
	Sequence:CCGGGCAACTTACATCAACTACAGACTCGAGTCTGTAGTTGATGTAAGTTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320649
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_002712.1-1197s21c1
	Sequence:CCGGCAGTCACAAACCCAATGGCAACTCGAGTTGCCATTGGGTTTGTGACTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000002469
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002712.x-563s1c1
	Sequence:CCGGGCAACTTACATCAACTACAGACTCGAGTCTGTAGTTGATGTAAGTTGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000380664
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-407s21c1
	Sequence:GTACCGGAGATCAAGAAGATTGAGAATCCTCGAGGATTCTCAATCTTCTTGATCTTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381508
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-914s21c1
	Sequence:GTACCGGAGTTCTGGATGAACGACAATCCTCGAGGATTGTCGTTCATCCAGAACTTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320726
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_002712.1-184s21c1
	Sequence:CCGGGAGGACCCAGAAGAAGAACATCTCGAGATGTTCTTCTTCTGGGTCCTCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000320729
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-378s21c1
	Sequence:CCGGTCTTCGAGAGCTGGATCTTTACTCGAGTAAAGATCCAGCTCTCGAAGATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000379822
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: MCF7
	TRC Version: 2	Clone ID:NM_002712.1-254s21c1
	Sequence:GTACCGGATGTTGATTTGAATCACTATCCTCGAGGATAGTGATTCAAATCAACATTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_023200 VALIDATED	PPP1R7 MISSION shRNA Bacterial Glycerol Stock protein phosphatase 1, regulatory subunit 7	Mouse

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000087825
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023200.1-797s1c1
	Sequence:CCGGGCAACAATGGTATCGAGGTTACTCGAGTAACCTCGATACCATTGTTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000087824
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_023200.1-566s1c1
	Sequence:CCGGGCAATTTACATCAACTGCAAACTCGAGTTTGCAGTTGATGTAAATTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000087827
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023200.1-798s1c1
	Sequence:CCGGCAACAATGGTATCGAGGTTATCTCGAGATAACCTCGATACCATTGTTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000087823
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_023200.1-2062s1c1
	Sequence:CCGGGCCACATATCATGGAAGGTATCTCGAGATACCTTCCATGATATGTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000087826
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_023200.1-478s1c1
	Sequence:CCGGCTGAGGAACATTGAAGGGATTCTCGAGAATCCCTTCAATGTTCCTCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306886
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_023200.2-771s21c1
	Sequence:CCGGGGTGAACCTGCGGGAACTATACTCGAGTATAGTTCCCGCAGGTTCACCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288430
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_023200.2-478s21c1
	Sequence:CCGGCTGAGGAACATTGAAGGGATTCTCGAGAATCCCTTCAATGTTCCTCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288429
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023200.2-798s21c1
	Sequence:CCGGCAACAATGGTATCGAGGTTATCTCGAGATAACCTCGATACCATTGTTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288512
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023200.2-566s21c1
	Sequence:CCGGGCAATTTACATCAACTGCAAACTCGAGTTTGCAGTTGATGTAAATTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295755
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023200.2-1174s21c1
	Sequence:CCGGGCTCCTGATGTCGTCACTATACTCGAGTATAGTGACGACATCAGGAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_023200 VALIDATED	PPP1R7 MISSION shRNA shRNA Plasmid DNA protein phosphatase 1, regulatory subunit 7	Mouse

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000087825
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023200.1-797s1c1
	Sequence:CCGGGCAACAATGGTATCGAGGTTACTCGAGTAACCTCGATACCATTGTTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000087824
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_023200.1-566s1c1
	Sequence:CCGGGCAATTTACATCAACTGCAAACTCGAGTTTGCAGTTGATGTAAATTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000087827
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023200.1-798s1c1
	Sequence:CCGGCAACAATGGTATCGAGGTTATCTCGAGATAACCTCGATACCATTGTTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000087823
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_023200.1-2062s1c1
	Sequence:CCGGGCCACATATCATGGAAGGTATCTCGAGATACCTTCCATGATATGTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000087826
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_023200.1-478s1c1
	Sequence:CCGGCTGAGGAACATTGAAGGGATTCTCGAGAATCCCTTCAATGTTCCTCAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306886
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_023200.2-771s21c1
	Sequence:CCGGGGTGAACCTGCGGGAACTATACTCGAGTATAGTTCCCGCAGGTTCACCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288430
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_023200.2-478s21c1
	Sequence:CCGGCTGAGGAACATTGAAGGGATTCTCGAGAATCCCTTCAATGTTCCTCAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288429
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023200.2-798s21c1
	Sequence:CCGGCAACAATGGTATCGAGGTTATCTCGAGATAACCTCGATACCATTGTTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288512
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023200.2-566s21c1
	Sequence:CCGGGCAATTTACATCAACTGCAAACTCGAGTTTGCAGTTGATGTAAATTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295755
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023200.2-1174s21c1
	Sequence:CCGGGCTCCTGATGTCGTCACTATACTCGAGTATAGTGACGACATCAGGAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_023200 VALIDATED	PPP1R7 MISSION shRNA Lentiviral Transduction Particles protein phosphatase 1, regulatory subunit 7	Mouse

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000087825
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023200.1-797s1c1
	Sequence:CCGGGCAACAATGGTATCGAGGTTACTCGAGTAACCTCGATACCATTGTTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000087824
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_023200.1-566s1c1
	Sequence:CCGGGCAATTTACATCAACTGCAAACTCGAGTTTGCAGTTGATGTAAATTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000087827
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023200.1-798s1c1
	Sequence:CCGGCAACAATGGTATCGAGGTTATCTCGAGATAACCTCGATACCATTGTTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000087823
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_023200.1-2062s1c1
	Sequence:CCGGGCCACATATCATGGAAGGTATCTCGAGATACCTTCCATGATATGTGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000087826
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_023200.1-478s1c1
	Sequence:CCGGCTGAGGAACATTGAAGGGATTCTCGAGAATCCCTTCAATGTTCCTCAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306886
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_023200.2-771s21c1
	Sequence:CCGGGGTGAACCTGCGGGAACTATACTCGAGTATAGTTCCCGCAGGTTCACCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288430
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_023200.2-478s21c1
	Sequence:CCGGCTGAGGAACATTGAAGGGATTCTCGAGAATCCCTTCAATGTTCCTCAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288429
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023200.2-798s21c1
	Sequence:CCGGCAACAATGGTATCGAGGTTATCTCGAGATAACCTCGATACCATTGTTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288512
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023200.2-566s21c1
	Sequence:CCGGGCAATTTACATCAACTGCAAACTCGAGTTTGCAGTTGATGTAAATTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295755
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023200.2-1174s21c1
	Sequence:CCGGGCTCCTGATGTCGTCACTATACTCGAGTATAGTGACGACATCAGGAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart