EMAIL THIS PAGE TO A FRIEND

PPP1R8

protein phosphatase 1, regulatory subunit 8

175 Gene Product Result for
Synonyms: ARD-1 ARD1 NIPP-1 NIPP1 PRO2047
Gene ID:
Human(5511) Summary: This gene, through alternative splicing, encodes three different isoforms. Two of the protein isoforms encoded by this gene are specific inhibitors of type 1 serine/threonine protein phosphatases and can bind but not cleave RNA. The third protein isoform lacks the phosphatase inhibitory function but is a single-strand endoribonuclease comparable to RNase E of E. coli. This isoform requires magnesium for its function and cleaves specific sites in A+U-rich regions of RNA. [provided by RefSeq, Jul 2008]
Mouse(100336) protein phosphatase 1, regulatory (inhibitor) subunit 8
Rat(313030) protein phosphatase 1, regulatory subunit 8
Zebrafish(566830) protein phosphatase 1, regulatory (inhibitor) subunit 8
Horse(100056729) protein phosphatase 1, regulatory subunit 8
domestic cat(101084555) protein phosphatase 1, regulatory subunit 8
chicken(419564) protein phosphatase 1, regulatory subunit 8
dog(487340) protein phosphatase 1, regulatory subunit 8
cow(282319) protein phosphatase 1, regulatory subunit 8
sheep(101105555) protein phosphatase 1, regulatory subunit 8
naked mole-rat(101707477) protein phosphatase 1, regulatory subunit 8
domestic guinea pig(100722083) protein phosphatase 1, regulatory subunit 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
ABC61-M Anti-NIPP-1 Antibody clone, from rabbit, purified by affinity chromatography mouse, human
immunocytochemistry, western blot pricing
SAB2500695 Anti-NIPP1/PPP1R8 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
HPA027452 Anti-PPP1R8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab3 Antibody Enhanced Validation human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502295 Anti-PPP1R8 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB2103015 Anti-PPP1R8 antibody produced in rabbit affinity isolated antibody rat, dog, bovine, horse, human, pig
western blot pricing
HPA027406 Anti-PPP1R8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 Antibody Enhanced Validation human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA027417 Anti-PPP1R8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 Antibody Enhanced Validation rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1404233 Monoclonal Anti-PPP1R8 antibody produced in mouse clone 1G11, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002713 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002713 Rosetta Predictions human pricing
NM_014110 Rosetta Predictions human pricing
NM_138558 Rosetta Predictions human pricing
NM_001107911 Rosetta Predictions rat pricing
NM_146154 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190936 predicted 1167
2 SASI_Hs01_00190937 predicted 1795
3 SASI_Hs02_00334300 predicted 1643
4 SASI_Hs01_00190940 predicted 1264
5 SASI_Hs02_00334301 predicted 1531
6 SASI_Hs02_00334302 predicted 1077
7 SASI_Hs02_00334303 predicted 1546
8 SASI_Hs01_00190943 predicted 1448
9 SASI_Hs01_00190944 predicted 1249
10 SASI_Hs01_00190945 predicted 997
11 SASI_Hs01_00190938 predicted 1833
12 SASI_Hs01_00190939 predicted 1692
13 SASI_Hs01_00190941 predicted 1347
14 SASI_Hs01_00190942 predicted 1752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196240 predicted 912
2 SASI_Hs01_00196241 predicted 1538
3 SASI_Hs02_00345118 predicted 1389
4 SASI_Hs01_00196244 predicted 1007
5 SASI_Hs02_00345119 predicted 1274
6 SASI_Hs02_00345120 predicted 822
7 SASI_Hs02_00345121 predicted 1301
8 SASI_Hs01_00196247 predicted 1192
9 SASI_Hs01_00196248 predicted 996
10 SASI_Hs01_00196249 predicted 748
11 SASI_Hs01_00196242 predicted 1578
12 SASI_Hs01_00196243 predicted 1439
13 SASI_Hs01_00196245 predicted 1092
14 SASI_Hs01_00196246 predicted 1494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167566 predicted 1262
2 SASI_Hs01_00167567 predicted 1900
3 SASI_Hs02_00363702 predicted 1744
4 SASI_Hs01_00167570 predicted 1371
5 SASI_Hs02_00363703 predicted 1629
6 SASI_Hs02_00363704 predicted 1178
7 SASI_Hs02_00363705 predicted 1650
8 SASI_Hs01_00167573 predicted 1543
9 SASI_Hs01_00167574 predicted 1355
10 SASI_Hs01_00167575 predicted 1096
11 SASI_Hs01_00167568 predicted 1933
12 SASI_Hs01_00167569 predicted 1798
13 SASI_Hs01_00167571 predicted 1448
14 SASI_Hs01_00167572 predicted 1854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233495 predicted 540
2 SASI_Rn02_00233496 predicted 947
3 SASI_Rn02_00233497 predicted 969
4 SASI_Rn02_00233498 predicted 850
5 SASI_Rn02_00233499 predicted 507
6 SASI_Rn02_00233500 predicted 1052
7 SASI_Rn02_00233501 predicted 865
8 SASI_Rn02_00233502 predicted 529
9 SASI_Rn02_00233503 predicted 817
10 SASI_Rn02_00233504 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103144 predicted 1156
2 SASI_Mm01_00103145 predicted 1124
3 SASI_Mm01_00103146 predicted 344
4 SASI_Mm02_00341842 predicted 338
5 SASI_Mm01_00103147 predicted 468
6 SASI_Mm01_00103148 predicted 518
7 SASI_Mm01_00103149 predicted 395
8 SASI_Mm01_00103151 predicted 867
9 SASI_Mm01_00103152 predicted 528
10 SASI_Mm01_00103153 predicted 464
11 SASI_Mm01_00103150 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146154
VALIDATED
PPP1R8 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146154.1-544s21c1
Sequence:CCGGGCGGATTTCAACCCTCACTATCTCGAGATAGTGAGGGTTGAAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146154.1-1723s21c1
Sequence:CCGGCCTGGTGAACAGGAAGACTATCTCGAGATAGTCTTCCTGTTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146154.1-1053s21c1
Sequence:CCGGCCACACCTTCCTTACTGATTTCTCGAGAAATCAGTAAGGAAGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146154.1-348s21c1
Sequence:CCGGCCATCGATTCTACGGTCTCATCTCGAGATGAGACCGTAGAATCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146154.1-348s1c1
Sequence:CCGGCCATCGATTCTACGGTCTCATCTCGAGATGAGACCGTAGAATCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146154.1-127s21c1
Sequence:CCGGGCTAATTGAGAAGCTGATTATCTCGAGATAATCAGCTTCTCAATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146154.1-1723s1c1
Sequence:CCGGCCTGGTGAACAGGAAGACTATCTCGAGATAGTCTTCCTGTTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146154.1-544s1c1
Sequence:CCGGGCGGATTTCAACCCTCACTATCTCGAGATAGTGAGGGTTGAAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146154.1-127s1c1
Sequence:CCGGGCTAATTGAGAAGCTGATTATCTCGAGATAATCAGCTTCTCAATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146154.1-1053s1c1
Sequence:CCGGCCACACCTTCCTTACTGATTTCTCGAGAAATCAGTAAGGAAGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146154
VALIDATED
PPP1R8 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146154.1-544s21c1
Sequence:CCGGGCGGATTTCAACCCTCACTATCTCGAGATAGTGAGGGTTGAAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146154.1-1723s21c1
Sequence:CCGGCCTGGTGAACAGGAAGACTATCTCGAGATAGTCTTCCTGTTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146154.1-1053s21c1
Sequence:CCGGCCACACCTTCCTTACTGATTTCTCGAGAAATCAGTAAGGAAGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146154.1-348s21c1
Sequence:CCGGCCATCGATTCTACGGTCTCATCTCGAGATGAGACCGTAGAATCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146154.1-348s1c1
Sequence:CCGGCCATCGATTCTACGGTCTCATCTCGAGATGAGACCGTAGAATCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146154.1-127s21c1
Sequence:CCGGGCTAATTGAGAAGCTGATTATCTCGAGATAATCAGCTTCTCAATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146154.1-1723s1c1
Sequence:CCGGCCTGGTGAACAGGAAGACTATCTCGAGATAGTCTTCCTGTTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146154.1-544s1c1
Sequence:CCGGGCGGATTTCAACCCTCACTATCTCGAGATAGTGAGGGTTGAAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146154.1-127s1c1
Sequence:CCGGGCTAATTGAGAAGCTGATTATCTCGAGATAATCAGCTTCTCAATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146154.1-1053s1c1
Sequence:CCGGCCACACCTTCCTTACTGATTTCTCGAGAAATCAGTAAGGAAGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146154
VALIDATED
PPP1R8 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146154.1-544s21c1
Sequence:CCGGGCGGATTTCAACCCTCACTATCTCGAGATAGTGAGGGTTGAAATCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000324639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146154.1-1723s21c1
Sequence:CCGGCCTGGTGAACAGGAAGACTATCTCGAGATAGTCTTCCTGTTCACCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000324701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146154.1-1053s21c1
Sequence:CCGGCCACACCTTCCTTACTGATTTCTCGAGAAATCAGTAAGGAAGGTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146154.1-348s21c1
Sequence:CCGGCCATCGATTCTACGGTCTCATCTCGAGATGAGACCGTAGAATCGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146154.1-348s1c1
Sequence:CCGGCCATCGATTCTACGGTCTCATCTCGAGATGAGACCGTAGAATCGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000324638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146154.1-127s21c1
Sequence:CCGGGCTAATTGAGAAGCTGATTATCTCGAGATAATCAGCTTCTCAATTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146154.1-1723s1c1
Sequence:CCGGCCTGGTGAACAGGAAGACTATCTCGAGATAGTCTTCCTGTTCACCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146154.1-544s1c1
Sequence:CCGGGCGGATTTCAACCCTCACTATCTCGAGATAGTGAGGGTTGAAATCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146154.1-127s1c1
Sequence:CCGGGCTAATTGAGAAGCTGATTATCTCGAGATAATCAGCTTCTCAATTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146154.1-1053s1c1
Sequence:CCGGCCACACCTTCCTTACTGATTTCTCGAGAAATCAGTAAGGAAGGTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002713
VALIDATED
PPP1R8 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1644s21c1
Sequence:GTACCGGTCCCACTTTCTAGGATCATTTCTCGAGAAATGATCCTAGAAAGTGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1349s21c1
Sequence:CCGGTTCCTTGCTGATTTGATATTTCTCGAGAAATATCAAATCAGCAAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1272s21c1
Sequence:CCGGTATAACCCTGAAGCTGTAAATCTCGAGATTTACAGCTTCAGGGTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1228s21c1
Sequence:CCGGTGCCGTCAGCAGTGAACATGACTCGAGTCATGTTCACTGCTGACGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002713.x-1241s1c1
Sequence:CCGGGAACATGAACCCTGCACCAAACTCGAGTTTGGTGCAGGGTTCATGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1176s21c1
Sequence:CCGGTTGCCCATGCCATACCCAAACCTCGAGGTTTGGGTATGGCATGGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_002713.x-1342s1c1
Sequence:CCGGCCACACCTTCCTTGCTGATTTCTCGAGAAATCAGCAAGGAAGGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002713.x-2306s1c1
Sequence:CCGGCATAGGAGACAAAGTTAGGAACTCGAGTTCCTAACTTTGTCTCCTATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002713.x-1280s1c1
Sequence:CCGGTGAAGCTGTAAATGAACCCAACTCGAGTTGGGTTCATTTACAGCTTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002713.x-1286s1c1
Sequence:CCGGTGTAAATGAACCCAAGAAGAACTCGAGTTCTTCTTGGGTTCATTTACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002713
VALIDATED
PPP1R8 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1644s21c1
Sequence:GTACCGGTCCCACTTTCTAGGATCATTTCTCGAGAAATGATCCTAGAAAGTGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1349s21c1
Sequence:CCGGTTCCTTGCTGATTTGATATTTCTCGAGAAATATCAAATCAGCAAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1272s21c1
Sequence:CCGGTATAACCCTGAAGCTGTAAATCTCGAGATTTACAGCTTCAGGGTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1228s21c1
Sequence:CCGGTGCCGTCAGCAGTGAACATGACTCGAGTCATGTTCACTGCTGACGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002713.x-1241s1c1
Sequence:CCGGGAACATGAACCCTGCACCAAACTCGAGTTTGGTGCAGGGTTCATGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1176s21c1
Sequence:CCGGTTGCCCATGCCATACCCAAACCTCGAGGTTTGGGTATGGCATGGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_002713.x-1342s1c1
Sequence:CCGGCCACACCTTCCTTGCTGATTTCTCGAGAAATCAGCAAGGAAGGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002713.x-2306s1c1
Sequence:CCGGCATAGGAGACAAAGTTAGGAACTCGAGTTCCTAACTTTGTCTCCTATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002713.x-1280s1c1
Sequence:CCGGTGAAGCTGTAAATGAACCCAACTCGAGTTGGGTTCATTTACAGCTTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002713.x-1286s1c1
Sequence:CCGGTGTAAATGAACCCAAGAAGAACTCGAGTTCTTCTTGGGTTCATTTACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002713
VALIDATED
PPP1R8 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1644s21c1
Sequence:GTACCGGTCCCACTTTCTAGGATCATTTCTCGAGAAATGATCCTAGAAAGTGGGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000226413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1349s21c1
Sequence:CCGGTTCCTTGCTGATTTGATATTTCTCGAGAAATATCAAATCAGCAAGGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000226412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1272s21c1
Sequence:CCGGTATAACCCTGAAGCTGTAAATCTCGAGATTTACAGCTTCAGGGTTATATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000226411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1228s21c1
Sequence:CCGGTGCCGTCAGCAGTGAACATGACTCGAGTCATGTTCACTGCTGACGGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_002713.x-1241s1c1
Sequence:CCGGGAACATGAACCCTGCACCAAACTCGAGTTTGGTGCAGGGTTCATGTTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000226410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002713.2-1176s21c1
Sequence:CCGGTTGCCCATGCCATACCCAAACCTCGAGGTTTGGGTATGGCATGGGCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_002713.x-1342s1c1
Sequence:CCGGCCACACCTTCCTTGCTGATTTCTCGAGAAATCAGCAAGGAAGGTGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002713.x-2306s1c1
Sequence:CCGGCATAGGAGACAAAGTTAGGAACTCGAGTTCCTAACTTTGTCTCCTATGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002713.x-1280s1c1
Sequence:CCGGTGAAGCTGTAAATGAACCCAACTCGAGTTGGGTTCATTTACAGCTTCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002713.x-1286s1c1
Sequence:CCGGTGTAAATGAACCCAAGAAGAACTCGAGTTCTTCTTGGGTTCATTTACATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???