EMAIL THIS PAGE TO A FRIEND

PPP1R9A

protein phosphatase 1, regulatory subunit 9A

259 Gene Product Result for
Synonyms: NRB1 NRBI Neurabin-I
Gene ID:
Human(55607) Summary: This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(243725) protein phosphatase 1, regulatory (inhibitor) subunit 9A
Rat(84685) protein phosphatase 1, regulatory subunit 9A
Zebrafish(560862) protein phosphatase 1, regulatory (inhibitor) subunit 9A
chicken(420568) protein phosphatase 1, regulatory (inhibitor) subunit 9A
dog(482308) protein phosphatase 1, regulatory subunit 9A
Horse(100051837) protein phosphatase 1, regulatory subunit 9A
domestic cat(101090599) protein phosphatase 1, regulatory subunit 9A
domestic guinea pig(100720996) protein phosphatase 1, regulatory subunit 9A
naked mole-rat(101724860) protein phosphatase 1, regulatory subunit 9A
Domestic Rabbit(100340579) protein phosphatase 1, regulatory subunit 9A
cow(539311) protein phosphatase 1, regulatory subunit 9A
sheep(101115785) protein phosphatase 1, regulatory subunit 9A
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_371933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371933 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017650 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017650 Rosetta Predictions human pricing
NM_053473 Rosetta Predictions rat pricing
NM_181595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183260 predicted 2481
2 SASI_Hs01_00183261 predicted 894
3 SASI_Hs01_00183264 predicted 2402
4 SASI_Hs02_00350349 predicted 3216
5 SASI_Hs01_00183265 predicted 2311
6 SASI_Hs01_00183267 predicted 1966
7 SASI_Hs01_00183269 predicted 1584
8 SASI_Hs02_00350350 predicted 1275
9 SASI_Hs02_00350351 predicted 484
10 SASI_Hs02_00350352 predicted 1361
11 SASI_Hs01_00183262 predicted 3140
12 SASI_Hs01_00183263 predicted 3062
13 SASI_Hs01_00183266 predicted 1012
14 SASI_Hs01_00183268 predicted 1555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093243 predicted 2354
2 SASI_Rn01_00093244 predicted 2117
3 SASI_Rn01_00093245 predicted 2246
4 SASI_Rn01_00093246 predicted 298
5 SASI_Rn01_00093247 predicted 2777
6 SASI_Rn01_00093249 predicted 396
7 SASI_Rn01_00093250 predicted 1526
8 SASI_Rn02_00266064 predicted 925
9 SASI_Rn02_00266065 predicted 2985
10 SASI_Rn01_00093252 predicted 1767
11 SASI_Rn01_00093248 predicted 2263
12 SASI_Rn01_00093251 predicted 2177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111203 predicted 1896
2 SASI_Mm01_00111205 predicted 1562
3 SASI_Mm01_00111206 predicted 2242
4 SASI_Mm01_00111208 predicted 1651
5 SASI_Mm01_00111209 predicted 580
6 SASI_Mm01_00111210 predicted 2101
7 SASI_Mm01_00111211 predicted 707
8 SASI_Mm02_00349869 predicted 3061
9 SASI_Mm01_00111212 predicted 1128
10 SASI_Mm02_00349870 predicted 2014
11 SASI_Mm01_00111204 predicted 1055
12 SASI_Mm01_00111207 predicted 2210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181595
PPP1R9A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 9A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181595.2-5846s1c1
Sequence:CCGGCCTCTTATATTGCGTTTCTTACTCGAGTAAGAAACGCAATATAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181595.2-653s1c1
Sequence:CCGGGCCCAAAGAGTTTGTGGAGAACTCGAGTTCTCCACAAACTCTTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181595.2-1054s1c1
Sequence:CCGGCCCTCAATTTACCATCTGTTACTCGAGTAACAGATGGTAAATTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181595.2-2107s1c1
Sequence:CCGGGATTCGTTATTGGACGAGAAACTCGAGTTTCTCGTCCAATAACGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181595.2-2796s1c1
Sequence:CCGGGCTGAGGTGTTCAGACTACTACTCGAGTAGTAGTCTGAACACCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181595.3-1098s21c1
Sequence:CCGGGGCCGTCTCAAGGATTCTAATCTCGAGATTAGAATCCTTGAGACGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181595.3-3744s21c1
Sequence:CCGGACACCATTGTAGGCGGTTAAACTCGAGTTTAACCGCCTACAATGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181595.3-1727s21c1
Sequence:CCGGGTTTAGTTGTGCTCCGATTAACTCGAGTTAATCGGAGCACAACTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181595
PPP1R9A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 9A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181595.2-5846s1c1
Sequence:CCGGCCTCTTATATTGCGTTTCTTACTCGAGTAAGAAACGCAATATAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181595.2-653s1c1
Sequence:CCGGGCCCAAAGAGTTTGTGGAGAACTCGAGTTCTCCACAAACTCTTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181595.2-1054s1c1
Sequence:CCGGCCCTCAATTTACCATCTGTTACTCGAGTAACAGATGGTAAATTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181595.2-2107s1c1
Sequence:CCGGGATTCGTTATTGGACGAGAAACTCGAGTTTCTCGTCCAATAACGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181595.2-2796s1c1
Sequence:CCGGGCTGAGGTGTTCAGACTACTACTCGAGTAGTAGTCTGAACACCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181595.3-1098s21c1
Sequence:CCGGGGCCGTCTCAAGGATTCTAATCTCGAGATTAGAATCCTTGAGACGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181595.3-3744s21c1
Sequence:CCGGACACCATTGTAGGCGGTTAAACTCGAGTTTAACCGCCTACAATGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181595.3-1727s21c1
Sequence:CCGGGTTTAGTTGTGCTCCGATTAACTCGAGTTAATCGGAGCACAACTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181595
PPP1R9A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 9A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181595.2-5846s1c1
Sequence:CCGGCCTCTTATATTGCGTTTCTTACTCGAGTAAGAAACGCAATATAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181595.2-653s1c1
Sequence:CCGGGCCCAAAGAGTTTGTGGAGAACTCGAGTTCTCCACAAACTCTTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181595.2-1054s1c1
Sequence:CCGGCCCTCAATTTACCATCTGTTACTCGAGTAACAGATGGTAAATTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181595.2-2107s1c1
Sequence:CCGGGATTCGTTATTGGACGAGAAACTCGAGTTTCTCGTCCAATAACGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181595.2-2796s1c1
Sequence:CCGGGCTGAGGTGTTCAGACTACTACTCGAGTAGTAGTCTGAACACCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181595.3-1098s21c1
Sequence:CCGGGGCCGTCTCAAGGATTCTAATCTCGAGATTAGAATCCTTGAGACGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181595.3-3744s21c1
Sequence:CCGGACACCATTGTAGGCGGTTAAACTCGAGTTTAACCGCCTACAATGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181595.3-1727s21c1
Sequence:CCGGGTTTAGTTGTGCTCCGATTAACTCGAGTTAATCGGAGCACAACTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371933
VALIDATED
PPP1R9A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 9A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371933.1-3001s1c1
Sequence:CCGGGCCATCAAACAGTTTCTATAACTCGAGTTATAGAAACTGTTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:XM_371933.1-3638s1c1
Sequence:CCGGCCTGAGACTCTAATTTCAGATCTCGAGATCTGAAATTAGAGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:XM_371933.1-2147s1c1
Sequence:CCGGGCCACAGATGAAGAAGAAGATCTCGAGATCTTCTTCTTCATCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371933.1-947s1c1
Sequence:CCGGCCCTTGAATTTACCATCTGTTCTCGAGAACAGATGGTAAATTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_371933.1-1022s1c1
Sequence:CCGGCCTTCAAACAAGCGAGGTGTTCTCGAGAACACCTCGCTTGTTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371933
VALIDATED
PPP1R9A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 9A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371933.1-3001s1c1
Sequence:CCGGGCCATCAAACAGTTTCTATAACTCGAGTTATAGAAACTGTTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:XM_371933.1-3638s1c1
Sequence:CCGGCCTGAGACTCTAATTTCAGATCTCGAGATCTGAAATTAGAGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:XM_371933.1-2147s1c1
Sequence:CCGGGCCACAGATGAAGAAGAAGATCTCGAGATCTTCTTCTTCATCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371933.1-947s1c1
Sequence:CCGGCCCTTGAATTTACCATCTGTTCTCGAGAACAGATGGTAAATTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_371933.1-1022s1c1
Sequence:CCGGCCTTCAAACAAGCGAGGTGTTCTCGAGAACACCTCGCTTGTTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371933
VALIDATED
PPP1R9A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 9A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371933.1-3001s1c1
Sequence:CCGGGCCATCAAACAGTTTCTATAACTCGAGTTATAGAAACTGTTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:XM_371933.1-3638s1c1
Sequence:CCGGCCTGAGACTCTAATTTCAGATCTCGAGATCTGAAATTAGAGTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:XM_371933.1-2147s1c1
Sequence:CCGGGCCACAGATGAAGAAGAAGATCTCGAGATCTTCTTCTTCATCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371933.1-947s1c1
Sequence:CCGGCCCTTGAATTTACCATCTGTTCTCGAGAACAGATGGTAAATTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_371933.1-1022s1c1
Sequence:CCGGCCTTCAAACAAGCGAGGTGTTCTCGAGAACACCTCGCTTGTTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017650
VALIDATED
PPP1R9A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 9A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017650.2-1588s21c1
Sequence:CCGGGATATGGAGTACTCGGAAATTCTCGAGAATTTCCGAGTACTCCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017650.2-2185s21c1
Sequence:CCGGGCCACAGATGAAGAAGAAGATCTCGAGATCTTCTTCTTCATCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017650.2-3934s21c1
Sequence:CCGGTTAATGGAGCGCCGTGAATTTCTCGAGAAATTCACGGCGCTCCATTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017650.2-1468s21c1
Sequence:CCGGTACATGCACAGTGACTATAATCTCGAGATTATAGTCACTGTGCATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_017650.2-1496s21c1
Sequence:CCGGGGGTGAGATCCAGGTATAATTCTCGAGAATTATACCTGGATCTCACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017650
VALIDATED
PPP1R9A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 9A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017650.2-1588s21c1
Sequence:CCGGGATATGGAGTACTCGGAAATTCTCGAGAATTTCCGAGTACTCCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017650.2-2185s21c1
Sequence:CCGGGCCACAGATGAAGAAGAAGATCTCGAGATCTTCTTCTTCATCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017650.2-3934s21c1
Sequence:CCGGTTAATGGAGCGCCGTGAATTTCTCGAGAAATTCACGGCGCTCCATTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017650.2-1468s21c1
Sequence:CCGGTACATGCACAGTGACTATAATCTCGAGATTATAGTCACTGTGCATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_017650.2-1496s21c1
Sequence:CCGGGGGTGAGATCCAGGTATAATTCTCGAGAATTATACCTGGATCTCACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017650
VALIDATED
PPP1R9A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 9A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017650.2-1588s21c1
Sequence:CCGGGATATGGAGTACTCGGAAATTCTCGAGAATTTCCGAGTACTCCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017650.2-2185s21c1
Sequence:CCGGGCCACAGATGAAGAAGAAGATCTCGAGATCTTCTTCTTCATCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_017650.2-3934s21c1
Sequence:CCGGTTAATGGAGCGCCGTGAATTTCTCGAGAAATTCACGGCGCTCCATTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017650.2-1468s21c1
Sequence:CCGGTACATGCACAGTGACTATAATCTCGAGATTATAGTCACTGTGCATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_017650.2-1496s21c1
Sequence:CCGGGGGTGAGATCCAGGTATAATTCTCGAGAATTATACCTGGATCTCACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)