EMAIL THIS PAGE TO A FRIEND

PPP1R9B

protein phosphatase 1, regulatory subunit 9B

159 Gene Product Result for
Synonyms: PPP1R6 PPP1R9 SPINO Spn
UniProtKB ID: Q96SB3, Q8TCR9
Gene ID:
Human(84687) Summary: Spinophilin is a regulatory subunit of protein phosphatase-1 catalytic subunit (PP1; see MIM 176875) and is highly enriched in dendritic spines, specialized protrusions from dendritic shafts that receive most of the excitatory input in the central nervous system (Allen et al., 1997 [PubMed 9275233]
Mouse(217124) protein phosphatase 1, regulatory subunit 9B
Rat(84686) protein phosphatase 1, regulatory subunit 9B
cow(101906096) protein phosphatase 1, regulatory subunit 9B
sheep(101117778) protein phosphatase 1, regulatory subunit 9B
naked mole-rat(101701908) protein phosphatase 1, regulatory subunit 9B
domestic guinea pig(100733955) protein phosphatase 1, regulatory subunit 9B
chicken(395762) protein phosphatase 1, regulatory (inhibitor) subunit 9B
domestic cat(101092903) protein phosphatase 1, regulatory subunit 9B
dog(491076) protein phosphatase 1, regulatory subunit 9B
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
N5037 Anti-Neurabin II (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, canine
immunofluorescence, immunoprecipitation (IP), microarray, western blot pricing
N5162 Anti-Neurabin II antibody produced in rabbit affinity isolated antibody, buffered aqueous solution canine, mouse, rat
immunofluorescence, immunoprecipitation (IP), microarray, western blot pricing
SAB1306820 ANTI-PPP1R9B(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032595 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032595 Rosetta Predictions human pricing
NM_053474 Rosetta Predictions rat pricing
NM_172261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231102 predicted 1765
2 SASI_Hs01_00231103 predicted 2883
3 SASI_Hs01_00231104 predicted 1761
4 SASI_Hs01_00231105 predicted 1367
5 SASI_Hs01_00231106 predicted 1929
6 SASI_Hs01_00231107 predicted 1569
7 SASI_Hs01_00231108 predicted 1563
8 SASI_Hs01_00231109 predicted 1870
9 SASI_Hs01_00231110 predicted 1627
10 SASI_Hs02_00360135 predicted 1133
11 SASI_Hs01_00231101 predicted 1973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039033 predicted 2336
2 SASI_Rn02_00266066 predicted 2446
3 SASI_Rn02_00266067 predicted 2278
4 SASI_Rn01_00039034 predicted 2948
5 SASI_Rn01_00039035 predicted 2376
6 SASI_Rn01_00039036 predicted 2947
7 SASI_Rn01_00039037 predicted 2886
8 SASI_Rn01_00039038 predicted 2354
9 SASI_Rn01_00039039 predicted 2457
10 SASI_Rn02_00266068 predicted 1879
11 SASI_Rn01_00039032 predicted 2273
12 SASI_Rn01_00039040 predicted 2972
13 SASI_Rn01_00039041 predicted 2758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121421 predicted 2775
2 SASI_Mm01_00121422 predicted 2263
3 SASI_Mm02_00343727 predicted 2768
4 SASI_Mm02_00343728 predicted 2266
5 SASI_Mm01_00121424 predicted 2093
6 SASI_Mm01_00121425 predicted 2164
7 SASI_Mm01_00121426 predicted 2197
8 SASI_Mm01_00121427 predicted 2018
9 SASI_Mm01_00121428 predicted 2255
10 SASI_Mm01_00121429 predicted 1726
11 SASI_Mm01_00121423 predicted 1781
12 SASI_Mm01_00121430 predicted 2041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032595
VALIDATED
PPP1R9B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 9B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032595.3-1832s21c1
Sequence:CCGGAGCAGAGATACGCCCAGTATGCTCGAGCATACTGGGCGTATCTCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032595.3-1383s21c1
Sequence:CCGGCACTTACTCCAACGAGGATTACTCGAGTAATCCTCGTTGGAGTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032595.3-2449s21c1
Sequence:CCGGTCTACTTAACAGGAATCATTCCTCGAGGAATGATTCCTGTTAAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032595.3-1768s21c1
Sequence:CCGGAGCGAAGTGGCCCAGCTAATTCTCGAGAATTAGCTGGGCCACTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032595.3-2748s21c1
Sequence:CCGGACAAGCACCTGCAGATCAAACCTCGAGGTTTGATCTGCAGGTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032595.3-2883s21c1
Sequence:CCGGGGGCCTCTTGACTTGAGATTCCTCGAGGAATCTCAAGTCAAGAGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032595.x-1930s1c1
Sequence:CCGGGCCATCGAGGTGTTTGAGCTACTCGAGTAGCTCAAACACCTCGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032595.x-879s1c1
Sequence:CCGGGCGCAAGATTAAGCCGGTGGACTCGAGTCCACCGGCTTAATCTTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032595.x-2424s1c1
Sequence:CCGGGCAAACACTGAGGAATTCCAACTCGAGTTGGAATTCCTCAGTGTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032595.x-2157s1c1
Sequence:CCGGCATGGAGAAACTGGAAGGCTACTCGAGTAGCCTTCCAGTTTCTCCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032595.x-2283s1c1
Sequence:CCGGCATCAAGGACTACCAGCAGAACTCGAGTTCTGCTGGTAGTCCTTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032595
VALIDATED
PPP1R9B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 9B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032595.3-1832s21c1
Sequence:CCGGAGCAGAGATACGCCCAGTATGCTCGAGCATACTGGGCGTATCTCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032595.3-1383s21c1
Sequence:CCGGCACTTACTCCAACGAGGATTACTCGAGTAATCCTCGTTGGAGTAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032595.3-2449s21c1
Sequence:CCGGTCTACTTAACAGGAATCATTCCTCGAGGAATGATTCCTGTTAAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032595.3-1768s21c1
Sequence:CCGGAGCGAAGTGGCCCAGCTAATTCTCGAGAATTAGCTGGGCCACTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032595.3-2748s21c1
Sequence:CCGGACAAGCACCTGCAGATCAAACCTCGAGGTTTGATCTGCAGGTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032595.3-2883s21c1
Sequence:CCGGGGGCCTCTTGACTTGAGATTCCTCGAGGAATCTCAAGTCAAGAGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032595.x-1930s1c1
Sequence:CCGGGCCATCGAGGTGTTTGAGCTACTCGAGTAGCTCAAACACCTCGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032595.x-879s1c1
Sequence:CCGGGCGCAAGATTAAGCCGGTGGACTCGAGTCCACCGGCTTAATCTTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032595.x-2424s1c1
Sequence:CCGGGCAAACACTGAGGAATTCCAACTCGAGTTGGAATTCCTCAGTGTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032595.x-2157s1c1
Sequence:CCGGCATGGAGAAACTGGAAGGCTACTCGAGTAGCCTTCCAGTTTCTCCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032595.x-2283s1c1
Sequence:CCGGCATCAAGGACTACCAGCAGAACTCGAGTTCTGCTGGTAGTCCTTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032595
VALIDATED
PPP1R9B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 9B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032595.3-1832s21c1
Sequence:CCGGAGCAGAGATACGCCCAGTATGCTCGAGCATACTGGGCGTATCTCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032595.3-1383s21c1
Sequence:CCGGCACTTACTCCAACGAGGATTACTCGAGTAATCCTCGTTGGAGTAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032595.3-2449s21c1
Sequence:CCGGTCTACTTAACAGGAATCATTCCTCGAGGAATGATTCCTGTTAAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032595.3-1768s21c1
Sequence:CCGGAGCGAAGTGGCCCAGCTAATTCTCGAGAATTAGCTGGGCCACTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032595.3-2748s21c1
Sequence:CCGGACAAGCACCTGCAGATCAAACCTCGAGGTTTGATCTGCAGGTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032595.3-2883s21c1
Sequence:CCGGGGGCCTCTTGACTTGAGATTCCTCGAGGAATCTCAAGTCAAGAGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032595.x-1930s1c1
Sequence:CCGGGCCATCGAGGTGTTTGAGCTACTCGAGTAGCTCAAACACCTCGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032595.x-879s1c1
Sequence:CCGGGCGCAAGATTAAGCCGGTGGACTCGAGTCCACCGGCTTAATCTTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032595.x-2424s1c1
Sequence:CCGGGCAAACACTGAGGAATTCCAACTCGAGTTGGAATTCCTCAGTGTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032595.x-2157s1c1
Sequence:CCGGCATGGAGAAACTGGAAGGCTACTCGAGTAGCCTTCCAGTTTCTCCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032595.x-2283s1c1
Sequence:CCGGCATCAAGGACTACCAGCAGAACTCGAGTTCTGCTGGTAGTCCTTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172261
PPP1R9B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 9B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172261.2-3807s1c1
Sequence:CCGGGCCTGCTTTCTAAGTGAAATTCTCGAGAATTTCACTTAGAAAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172261.2-1701s1c1
Sequence:CCGGGATCCAAGTATTCAGCACCTACTCGAGTAGGTGCTGAATACTTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172261.2-2112s1c1
Sequence:CCGGCCAGCTAATTCAGCAGACCTTCTCGAGAAGGTCTGCTGAATTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172261.2-2769s1c1
Sequence:CCGGGAGGAACTCCAATTCTACTTACTCGAGTAAGTAGAATTGGAGTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172261.2-474s1c1
Sequence:CCGGCCATAAGAAATATGGCTCCAACTCGAGTTGGAGCCATATTTCTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172261
PPP1R9B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 9B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172261.2-3807s1c1
Sequence:CCGGGCCTGCTTTCTAAGTGAAATTCTCGAGAATTTCACTTAGAAAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172261.2-1701s1c1
Sequence:CCGGGATCCAAGTATTCAGCACCTACTCGAGTAGGTGCTGAATACTTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172261.2-2112s1c1
Sequence:CCGGCCAGCTAATTCAGCAGACCTTCTCGAGAAGGTCTGCTGAATTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172261.2-2769s1c1
Sequence:CCGGGAGGAACTCCAATTCTACTTACTCGAGTAAGTAGAATTGGAGTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172261.2-474s1c1
Sequence:CCGGCCATAAGAAATATGGCTCCAACTCGAGTTGGAGCCATATTTCTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172261
PPP1R9B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 9B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172261.2-3807s1c1
Sequence:CCGGGCCTGCTTTCTAAGTGAAATTCTCGAGAATTTCACTTAGAAAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172261.2-1701s1c1
Sequence:CCGGGATCCAAGTATTCAGCACCTACTCGAGTAGGTGCTGAATACTTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172261.2-2112s1c1
Sequence:CCGGCCAGCTAATTCAGCAGACCTTCTCGAGAAGGTCTGCTGAATTAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172261.2-2769s1c1
Sequence:CCGGGAGGAACTCCAATTCTACTTACTCGAGTAAGTAGAATTGGAGTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172261.2-474s1c1
Sequence:CCGGCCATAAGAAATATGGCTCCAACTCGAGTTGGAGCCATATTTCTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)