EMAIL THIS PAGE TO A FRIEND

PPP2CA

protein phosphatase 2, catalytic subunit, alpha isozyme

127 Gene Product Result for
Synonyms: PP2Ac PP2CA PP2Calpha RP-C
UniProtKB ID: P67775, P05323, P13197
Gene ID:
Human(5515) Summary: This gene encodes the phosphatase 2A catalytic subunit. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. This gene encodes an alpha isoform of the catalytic subunit. [provided by RefSeq, Jul 2008]
Mouse(19052) protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform
Rat(24672) protein phosphatase 2, catalytic subunit, alpha isozyme
Zebrafish(550585) protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform
domestic cat(101099271) protein phosphatase 2, catalytic subunit, alpha isozyme
dog(403608) protein phosphatase 2, catalytic subunit, alpha isozyme
chicken(416318) protein phosphatase 2, catalytic subunit, alpha isozyme
domestic guinea pig(100724172) protein phosphatase 2, catalytic subunit, alpha isozyme
naked mole-rat(101707511) protein phosphatase 2, catalytic subunit, alpha isozyme
Domestic Rabbit(100009252) protein phosphatase 2, catalytic subunit, alpha isozyme
cow(282320) protein phosphatase 2, catalytic subunit, alpha isozyme
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503975 Anti-phospho-PP2A-α (pTyr307) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306440 ANTI-PP2A ALPHA(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4502298 Anti-PP2A-α antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2500815 Anti-PPP2CA/PPP2CB antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, mouse, rabbit, pig, rat, human
ELISA, western blot pricing
P8109 Anti-Serine/Threonine Protein Phosphatase 2 A/A antibody produced in rabbit ~1 mg/mL, IgG fraction of antiserum, buffered aqueous solution bovine, human, mouse, rat
immunocytochemistry, microarray, western blot pricing
P8609 Anti-Serine/Threonine Protein Phosphatase 2C α/β antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution bovine, mouse, rabbit, human
immunoprecipitation (IP), microarray, western blot pricing
P6498 Monoclonal Anti-Protein Phosphatase 2Aα (PP2Aα) antibody produced in rat ~1.5 mg/mL, clone 6F9, purified immunoglobulin, buffered aqueous solution frog, mouse, human, rat
ELISA, immunoprecipitation (IP), western blot pricing
P8998 Monoclonal Anti-Protein Phosphatase 2Aα (PP2Aα) antibody produced in rat clone 5H4, tissue culture supernatant, buffered aqueous solution mouse, Xenopus, human
ELISA, immunoprecipitation (IP), microarray, western blot pricing
SAB4200266 MonoclonalAnti-PP2A, C subunit antibody produced in mouse ~1.0 mg/mL, clone 7A6, purified immunoglobulin human, rat, mouse
immunoprecipitation (IP), western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C7632 Cantharidin human pricing
D6908 DL-erythro-Dihydrosphingosine ≥99%, synthetic human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
05-547 Anti-phospho-PP2A Antibody, C subunit (Tyr307), clone 4B10 Anti-phospho-PP2A Antibody, C subunit (Tyr307), clone 4B10 detects level of phospho-PP2A & has been published & validated for use in ELISA. pricing
05-592 Anti-PP2A Antibody, B subunit, clone 2G9 Detect PP2A using this Anti-PP2A Antibody, B subunit, clone 2G9 validated for use in IH, IP & WB. pricing
06-222 Anti-PP2A Antibody, C subunit Anti-PP2A Antibody, C subunit is an antibody against PP2A for use in IP & WB. pricing
07-324 Anti-PP2A Antibody, C subunit This Anti-PP2A Antibody, C subunit is validated for use in WB for the detection of PP2A. pricing
05-421 Anti-PP2A Antibody, C subunit, clone 1D6 Detect PP2A using this Anti-PP2A Antibody, C subunit, clone 1D6 validated for use in IC, IP & WB. pricing
05-545 Anti-PP2A Antibody, C subunit, clone 7A6 Anti-PP2A Antibody, C subunit, clone 7A6 detects level of PP2A & has been published & validated for use in IP & WB. pricing
05-577 Anti-PP2A Antibody, C subunit, demethylated, clone 4b7 Anti-PP2A Antibody, C subunit, demethylated, clone 4b7 is an antibody against PP2A for use in IC, IP & WB. pricing
05-421-AF488 Anti-PP2A, C subunit Antibody, clone 1D6, Alexa Fluor® 488 Conjugate Anti-PP2A, C subunit Antibody, clone 1D6, Alexa Fluor® 488 Conjugate is an antibody against PP2A for use in Immunocytochemistry. pricing
MABE1783 Anti-PP2AC alpha/beta Antibody, clone 11H12 Anti-PP2AC alpha/beta, clone 11H12, Cat. No. MABE1783, is a highly specific mouse monoclonal antibody that targets Serine/threonine-protein phosphatase 2A catalytic subunit alpha and beta isoforms and has been tested for use in Western Blotting. pricing
FCMAB336PE Milli-Mark™ Anti-PP2A-PE Antibody, C subunit, clone 1D6 Milli-Mark Anti-PP2A-PE Antibody, C subunit, clone 1D6 detects level of PP2A & has been published & validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002715 siRNAs that have been validated in the lab human pricing
NM_017039 Rosetta Predictions rat pricing
NM_019411 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002715 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107753 validated 1037
2 SASI_Hs01_00107754 predicted 1391
3 SASI_Hs01_00107755 predicted 1341
4 SASI_Hs01_00107756 predicted 630
5 SASI_Hs01_00107757 predicted 614
6 SASI_Hs01_00107758 predicted 1042
7 SASI_Hs01_00107759 predicted 1038
8 SASI_Hs01_00107760 predicted 1216
9 SASI_Hs01_00107761 predicted 1183
10 SASI_Hs01_00107762 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089611 predicted 1128
2 SASI_Rn01_00089612 predicted 424
3 SASI_Rn01_00089613 predicted 415
4 SASI_Rn01_00089614 predicted 590
5 SASI_Rn01_00089616 predicted 506
6 SASI_Rn01_00089617 predicted 1019
7 SASI_Rn01_00089618 predicted 1165
8 SASI_Rn01_00089619 predicted 695
9 SASI_Rn01_00089620 predicted 1116
10 SASI_Rn02_00261226 predicted 1212
11 SASI_Rn01_00089615 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038232 predicted 1219
2 SASI_Mm01_00038233 predicted 607
3 SASI_Mm01_00038234 predicted 1189
4 SASI_Mm01_00038235 predicted 1015
5 SASI_Mm01_00038236 predicted 618
6 SASI_Mm01_00038237 predicted 1015
7 SASI_Mm01_00038238 predicted 456
8 SASI_Mm01_00038239 predicted 439
9 SASI_Mm01_00038240 predicted 1189
10 SASI_Mm01_00038241 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002715
VALIDATED
PPP2CA MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, catalytic subunit, alpha isozyme
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002715.x-1000s1c1
Sequence:CCGGACTATTGTTATCGTTGTGGTACTCGAGTACCACAACGATAACAATAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002715.x-1036s1c1
Sequence:CCGGTGGAACTTGACGATACTCTAACTCGAGTTAGAGTATCGTCAAGTTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002715.x-945s1c1
Sequence:CCGGGAGGGATATAACTGGTGCCATCTCGAGATGGCACCAGTTATATCCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-615s21c1
Sequence:GTACCGGGGCAAATCACCAGATACAAATCTCGAGATTTGTATCTGGTGATTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002715.x-1684s1c1
Sequence:CCGGCCCATGTTGTTCTTTGTTATTCTCGAGAATAACAAAGAACAACATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002715.x-578s1c1
Sequence:CCGGCACACAAGTTTATGGTTTCTACTCGAGTAGAAACCATAAACTTGTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-1124s21c1
Sequence:CCGGGCTAGTGATGGAGGGATATAACTCGAGTTATATCCCTCCATCACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-1156s21c1
Sequence:GTACCGGACCGGAATGTAGTAACGATTTCTCGAGAAATCGTTACTACATTCCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002715.2-1873s21c1
Sequence:CCGGCCCATGTTGTTCTTTGTTATTCTCGAGAATAACAAAGAACAACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-767s21c1
Sequence:CCGGCACACAAGTTTATGGTTTCTACTCGAGTAGAAACCATAAACTTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-1225s21c1
Sequence:CCGGTGGAACTTGACGATACTCTAACTCGAGTTAGAGTATCGTCAAGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002715
VALIDATED
PPP2CA MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, catalytic subunit, alpha isozyme
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002715.x-1000s1c1
Sequence:CCGGACTATTGTTATCGTTGTGGTACTCGAGTACCACAACGATAACAATAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002715.x-1036s1c1
Sequence:CCGGTGGAACTTGACGATACTCTAACTCGAGTTAGAGTATCGTCAAGTTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002715.x-945s1c1
Sequence:CCGGGAGGGATATAACTGGTGCCATCTCGAGATGGCACCAGTTATATCCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-615s21c1
Sequence:GTACCGGGGCAAATCACCAGATACAAATCTCGAGATTTGTATCTGGTGATTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002715.x-1684s1c1
Sequence:CCGGCCCATGTTGTTCTTTGTTATTCTCGAGAATAACAAAGAACAACATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002715.x-578s1c1
Sequence:CCGGCACACAAGTTTATGGTTTCTACTCGAGTAGAAACCATAAACTTGTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-1124s21c1
Sequence:CCGGGCTAGTGATGGAGGGATATAACTCGAGTTATATCCCTCCATCACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-1156s21c1
Sequence:GTACCGGACCGGAATGTAGTAACGATTTCTCGAGAAATCGTTACTACATTCCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002715.2-1873s21c1
Sequence:CCGGCCCATGTTGTTCTTTGTTATTCTCGAGAATAACAAAGAACAACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-767s21c1
Sequence:CCGGCACACAAGTTTATGGTTTCTACTCGAGTAGAAACCATAAACTTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-1225s21c1
Sequence:CCGGTGGAACTTGACGATACTCTAACTCGAGTTAGAGTATCGTCAAGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002715
VALIDATED
PPP2CA MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, catalytic subunit, alpha isozyme
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002715.x-1000s1c1
Sequence:CCGGACTATTGTTATCGTTGTGGTACTCGAGTACCACAACGATAACAATAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002715.x-1036s1c1
Sequence:CCGGTGGAACTTGACGATACTCTAACTCGAGTTAGAGTATCGTCAAGTTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002715.x-945s1c1
Sequence:CCGGGAGGGATATAACTGGTGCCATCTCGAGATGGCACCAGTTATATCCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-615s21c1
Sequence:GTACCGGGGCAAATCACCAGATACAAATCTCGAGATTTGTATCTGGTGATTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002715.x-1684s1c1
Sequence:CCGGCCCATGTTGTTCTTTGTTATTCTCGAGAATAACAAAGAACAACATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002715.x-578s1c1
Sequence:CCGGCACACAAGTTTATGGTTTCTACTCGAGTAGAAACCATAAACTTGTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-1124s21c1
Sequence:CCGGGCTAGTGATGGAGGGATATAACTCGAGTTATATCCCTCCATCACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-1156s21c1
Sequence:GTACCGGACCGGAATGTAGTAACGATTTCTCGAGAAATCGTTACTACATTCCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002715.2-1873s21c1
Sequence:CCGGCCCATGTTGTTCTTTGTTATTCTCGAGAATAACAAAGAACAACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-767s21c1
Sequence:CCGGCACACAAGTTTATGGTTTCTACTCGAGTAGAAACCATAAACTTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002715.2-1225s21c1
Sequence:CCGGTGGAACTTGACGATACTCTAACTCGAGTTAGAGTATCGTCAAGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019411
VALIDATED
PPP2CA MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, catalytic subunit, alpha isozyme
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019411.2-1368s1c1
Sequence:CCGGGCGACATTGTTGGTCAAGAATCTCGAGATTCTTGACCAACAATGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019411.2-452s1c1
Sequence:CCGGCCAGATACAAATTACCTGTTTCTCGAGAAACAGGTAATTTGTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019411.2-616s1c1
Sequence:CCGGCGACGAGTGTTTAAGGAAATACTCGAGTATTTCCTTAAACACTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019411.2-902s1c1
Sequence:CCGGGAGACATTTAATCATGCCAATCTCGAGATTGGCATGATTAAATGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019411.2-491s1c1
Sequence:CCGGAGAGGATATTACTCTGTTGAACTCGAGTTCAACAGAGTAATATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019411.4-451s21c1
Sequence:CCGGCCAGATACAAATTACCTGTTTCTCGAGAAACAGGTAATTTGTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-1367s21c1
Sequence:CCGGGCGACATTGTTGGTCAAGAATCTCGAGATTCTTGACCAACAATGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-982s21c1
Sequence:CCGGGACCGGAACGTAGTAACAATTCTCGAGAATTGTTACTACGTTCCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-951s21c1
Sequence:CCGGGCTGGTGATGGAGGGATATAACTCGAGTTATATCCCTCCATCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-615s21c1
Sequence:CCGGCGACGAGTGTTTAAGGAAATACTCGAGTATTTCCTTAAACACTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-1058s21c1
Sequence:CCGGTTGACGACACTCTTAAGTATTCTCGAGAATACTTAAGAGTGTCGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019411
VALIDATED
PPP2CA MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, catalytic subunit, alpha isozyme
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019411.2-1368s1c1
Sequence:CCGGGCGACATTGTTGGTCAAGAATCTCGAGATTCTTGACCAACAATGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019411.2-452s1c1
Sequence:CCGGCCAGATACAAATTACCTGTTTCTCGAGAAACAGGTAATTTGTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019411.2-616s1c1
Sequence:CCGGCGACGAGTGTTTAAGGAAATACTCGAGTATTTCCTTAAACACTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019411.2-902s1c1
Sequence:CCGGGAGACATTTAATCATGCCAATCTCGAGATTGGCATGATTAAATGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019411.2-491s1c1
Sequence:CCGGAGAGGATATTACTCTGTTGAACTCGAGTTCAACAGAGTAATATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019411.4-451s21c1
Sequence:CCGGCCAGATACAAATTACCTGTTTCTCGAGAAACAGGTAATTTGTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-1367s21c1
Sequence:CCGGGCGACATTGTTGGTCAAGAATCTCGAGATTCTTGACCAACAATGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-982s21c1
Sequence:CCGGGACCGGAACGTAGTAACAATTCTCGAGAATTGTTACTACGTTCCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-951s21c1
Sequence:CCGGGCTGGTGATGGAGGGATATAACTCGAGTTATATCCCTCCATCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-615s21c1
Sequence:CCGGCGACGAGTGTTTAAGGAAATACTCGAGTATTTCCTTAAACACTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-1058s21c1
Sequence:CCGGTTGACGACACTCTTAAGTATTCTCGAGAATACTTAAGAGTGTCGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019411
VALIDATED
PPP2CA MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, catalytic subunit, alpha isozyme
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019411.2-1368s1c1
Sequence:CCGGGCGACATTGTTGGTCAAGAATCTCGAGATTCTTGACCAACAATGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019411.2-452s1c1
Sequence:CCGGCCAGATACAAATTACCTGTTTCTCGAGAAACAGGTAATTTGTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019411.2-616s1c1
Sequence:CCGGCGACGAGTGTTTAAGGAAATACTCGAGTATTTCCTTAAACACTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019411.2-902s1c1
Sequence:CCGGGAGACATTTAATCATGCCAATCTCGAGATTGGCATGATTAAATGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019411.2-491s1c1
Sequence:CCGGAGAGGATATTACTCTGTTGAACTCGAGTTCAACAGAGTAATATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019411.4-451s21c1
Sequence:CCGGCCAGATACAAATTACCTGTTTCTCGAGAAACAGGTAATTTGTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-1367s21c1
Sequence:CCGGGCGACATTGTTGGTCAAGAATCTCGAGATTCTTGACCAACAATGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-982s21c1
Sequence:CCGGGACCGGAACGTAGTAACAATTCTCGAGAATTGTTACTACGTTCCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-951s21c1
Sequence:CCGGGCTGGTGATGGAGGGATATAACTCGAGTTATATCCCTCCATCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-615s21c1
Sequence:CCGGCGACGAGTGTTTAAGGAAATACTCGAGTATTTCCTTAAACACTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019411.4-1058s21c1
Sequence:CCGGTTGACGACACTCTTAAGTATTCTCGAGAATACTTAAGAGTGTCGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)