EMAIL THIS PAGE TO A FRIEND

PPP2CB

protein phosphatase 2, catalytic subunit, beta isozyme

113 Gene Product Result for
Synonyms: PP2Abeta PP2CB
UniProtKB ID: P62714, D3DSV4, P11082, Q6FHK5
Gene ID:
Human(5516) Summary: This gene encodes the phosphatase 2A catalytic subunit. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. This gene encodes a beta isoform of the catalytic subunit. [provided by RefSeq, Mar 2010]
Mouse(19053) protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform
Rat(24673) protein phosphatase 2, catalytic subunit, beta isozyme
cow(524361) protein phosphatase 2, catalytic subunit, beta isozyme
Domestic Rabbit(100009300) protein phosphatase 2, catalytic subunit, beta isozyme
naked mole-rat(101726191) protein phosphatase 2, catalytic subunit, beta isozyme
domestic guinea pig(100720727) protein phosphatase 2, catalytic subunit, beta isozyme
Zebrafish(406582) protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform
Horse(100062224) protein phosphatase 2, catalytic subunit, beta isozyme
domestic cat(101094667) protein phosphatase 2, catalytic subunit, beta isozyme
dog(482873) protein phosphatase 2, catalytic subunit, beta isozyme
chicken(396021) protein phosphatase 2, catalytic subunit, beta isozyme
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C7632 Cantharidin human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004156 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009552 siRNAs that have been validated in the lab human pricing
NM_004156 siRNAs that have been validated in the lab human pricing
NM_017040 Rosetta Predictions rat pricing
NM_017374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009552 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209387 validated 768
2 SASI_Hs01_00209388 predicted 810
3 SASI_Hs01_00209390 predicted 766
4 SASI_Hs01_00209392 predicted 682
5 SASI_Hs01_00209393 predicted 1139
6 SASI_Hs01_00209395 predicted 1134
7 SASI_Hs02_00305613 predicted 1238
8 SASI_Hs02_00305614 predicted 1158
9 SASI_Hs02_00305615 predicted 1237
10 SASI_Hs02_00305616 predicted 723
11 SASI_Hs01_00209386 predicted 863
12 SASI_Hs01_00209389 predicted 1326
13 SASI_Hs01_00209391 predicted 1336
14 SASI_Hs01_00209394 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004156 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190977 validated 591
2 SASI_Hs01_00190978 predicted 630
3 SASI_Hs01_00190980 predicted 594
4 SASI_Hs01_00190982 predicted 501
5 SASI_Hs01_00190983 predicted 957
6 SASI_Hs01_00190985 predicted 954
7 SASI_Hs02_00337008 predicted 1063
8 SASI_Hs02_00337009 predicted 984
9 SASI_Hs02_00337010 predicted 1056
10 SASI_Hs02_00337011 predicted 549
11 SASI_Hs01_00190976 predicted 685
12 SASI_Hs01_00190979 predicted 1147
13 SASI_Hs01_00190981 predicted 1161
14 SASI_Hs01_00190984 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033364 predicted 754
2 SASI_Rn01_00033365 predicted 969
3 SASI_Rn01_00033366 predicted 670
4 SASI_Rn01_00033367 predicted 1027
5 SASI_Rn01_00033368 predicted 1029
6 SASI_Rn02_00261227 predicted 725
7 SASI_Rn01_00033369 predicted 704
8 SASI_Rn01_00033370 predicted 495
9 SASI_Rn01_00033371 predicted 1038
10 SASI_Rn01_00033372 predicted 567
11 SASI_Rn01_00033373 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126453 predicted 521
2 SASI_Mm01_00126455 predicted 1014
3 SASI_Mm02_00323859 predicted 958
4 SASI_Mm01_00126456 predicted 612
5 SASI_Mm01_00126457 predicted 656
6 SASI_Mm01_00126458 predicted 1021
7 SASI_Mm02_00323860 predicted 714
8 SASI_Mm01_00126459 predicted 487
9 SASI_Mm02_00323861 predicted 559
10 SASI_Mm01_00126461 predicted 513
11 SASI_Mm01_00126454 predicted 734
12 SASI_Mm01_00126460 predicted 586
13 SASI_Mm01_00126462 predicted 880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004156
VALIDATED
PPP2CB MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, catalytic subunit, beta isozyme
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-756s21c1
Sequence:GTACCGGTAGACACACTGGATCATATAACTCGAGTTATATGATCCAGTGTGTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-632s21c1
Sequence:CCGGTGTCTGCGAAAGTATGGGAATCTCGAGATTCCCATACTTTCGCAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-582s21c1
Sequence:CCGGGAAATCACGAAAGCCGACAAACTCGAGTTTGTCGGCTTTCGTGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-593s21c1
Sequence:CCGGAGCCGACAAATTACCCAAGTACTCGAGTACTTGGGTAATTTGTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-1620s21c1
Sequence:CCGGAGGTTCTTCTTGGGAGTATGTCTCGAGACATACTCCCAAGAAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004156.x-490s1c1
Sequence:CCGGGCTTTAGTAGATGGACAGATACTCGAGTATCTGTCCATCTACTAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004156.x-379s1c1
Sequence:CCGGAGCCGACAAATTACCCAAGTACTCGAGTACTTGGGTAATTTGTCGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004156.x-418s1c1
Sequence:CCGGTGTCTGCGAAAGTATGGGAATCTCGAGATTCCCATACTTTCGCAGACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004156.x-1410s1c1
Sequence:CCGGAGGTTCTTCTTGGGAGTATGTCTCGAGACATACTCCCAAGAAGAACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004156.x-368s1c1
Sequence:CCGGGAAATCACGAAAGCCGACAAACTCGAGTTTGTCGGCTTTCGTGATTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004156
VALIDATED
PPP2CB MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, catalytic subunit, beta isozyme
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-756s21c1
Sequence:GTACCGGTAGACACACTGGATCATATAACTCGAGTTATATGATCCAGTGTGTCTATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000349621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-632s21c1
Sequence:CCGGTGTCTGCGAAAGTATGGGAATCTCGAGATTCCCATACTTTCGCAGACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000318493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-582s21c1
Sequence:CCGGGAAATCACGAAAGCCGACAAACTCGAGTTTGTCGGCTTTCGTGATTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000318551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-593s21c1
Sequence:CCGGAGCCGACAAATTACCCAAGTACTCGAGTACTTGGGTAATTTGTCGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000318552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-1620s21c1
Sequence:CCGGAGGTTCTTCTTGGGAGTATGTCTCGAGACATACTCCCAAGAAGAACCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004156.x-490s1c1
Sequence:CCGGGCTTTAGTAGATGGACAGATACTCGAGTATCTGTCCATCTACTAAAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004156.x-379s1c1
Sequence:CCGGAGCCGACAAATTACCCAAGTACTCGAGTACTTGGGTAATTTGTCGGCTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004156.x-418s1c1
Sequence:CCGGTGTCTGCGAAAGTATGGGAATCTCGAGATTCCCATACTTTCGCAGACATTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004156.x-1410s1c1
Sequence:CCGGAGGTTCTTCTTGGGAGTATGTCTCGAGACATACTCCCAAGAAGAACCTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004156.x-368s1c1
Sequence:CCGGGAAATCACGAAAGCCGACAAACTCGAGTTTGTCGGCTTTCGTGATTTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004156
VALIDATED
PPP2CB MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, catalytic subunit, beta isozyme
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000380254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-756s21c1
Sequence:GTACCGGTAGACACACTGGATCATATAACTCGAGTTATATGATCCAGTGTGTCTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-632s21c1
Sequence:CCGGTGTCTGCGAAAGTATGGGAATCTCGAGATTCCCATACTTTCGCAGACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-582s21c1
Sequence:CCGGGAAATCACGAAAGCCGACAAACTCGAGTTTGTCGGCTTTCGTGATTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-593s21c1
Sequence:CCGGAGCCGACAAATTACCCAAGTACTCGAGTACTTGGGTAATTTGTCGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004156.2-1620s21c1
Sequence:CCGGAGGTTCTTCTTGGGAGTATGTCTCGAGACATACTCCCAAGAAGAACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004156.x-490s1c1
Sequence:CCGGGCTTTAGTAGATGGACAGATACTCGAGTATCTGTCCATCTACTAAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004156.x-379s1c1
Sequence:CCGGAGCCGACAAATTACCCAAGTACTCGAGTACTTGGGTAATTTGTCGGCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004156.x-418s1c1
Sequence:CCGGTGTCTGCGAAAGTATGGGAATCTCGAGATTCCCATACTTTCGCAGACATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004156.x-1410s1c1
Sequence:CCGGAGGTTCTTCTTGGGAGTATGTCTCGAGACATACTCCCAAGAAGAACCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004156.x-368s1c1
Sequence:CCGGGAAATCACGAAAGCCGACAAACTCGAGTTTGTCGGCTTTCGTGATTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017374
VALIDATED
PPP2CB MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, catalytic subunit, beta isozyme
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-874s21c1
Sequence:CCGGGCCCAATGTGTGATCTCTTATCTCGAGATAAGAGATCACACATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-391s21c1
Sequence:CCGGGCGAGAAGGCTAAGGAAATTTCTCGAGAAATTTCCTTAGCCTTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-356s21c1
Sequence:CCGGTAAGCAGCTGAACGAGAACCACTCGAGTGGTTCTCGTTCAGCTGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-347s21c1
Sequence:CCGGGAACGAGTGTAAGCAGCTGAACTCGAGTTCAGCTGCTTACACTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-657s21c1
Sequence:CCGGCGGCAGATCACACAAGTGTATCTCGAGATACACTTGTGTGATCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017374.2-593s1c1
Sequence:CCGGGTAGCGTTAAAGGTGCGCTATCTCGAGATAGCGCACCTTTAACGCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017374.2-1628s1c1
Sequence:CCGGCCACTTCAATTCATAACCCTTCTCGAGAAGGGTTATGAATTGAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017374.2-653s1c1
Sequence:CCGGCGGCAGATCACACAAGTGTATCTCGAGATACACTTGTGTGATCTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017374.2-1109s1c1
Sequence:CCGGGCTGCTATCATGGAATTAGATCTCGAGATCTAATTCCATGATAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017374.2-870s1c1
Sequence:CCGGGCCCAATGTGTGATCTCTTATCTCGAGATAAGAGATCACACATTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017374
VALIDATED
PPP2CB MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, catalytic subunit, beta isozyme
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-874s21c1
Sequence:CCGGGCCCAATGTGTGATCTCTTATCTCGAGATAAGAGATCACACATTGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000294516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-391s21c1
Sequence:CCGGGCGAGAAGGCTAAGGAAATTTCTCGAGAAATTTCCTTAGCCTTCTCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000294515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-356s21c1
Sequence:CCGGTAAGCAGCTGAACGAGAACCACTCGAGTGGTTCTCGTTCAGCTGCTTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000294514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-347s21c1
Sequence:CCGGGAACGAGTGTAAGCAGCTGAACTCGAGTTCAGCTGCTTACACTCGTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000294579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-657s21c1
Sequence:CCGGCGGCAGATCACACAAGTGTATCTCGAGATACACTTGTGTGATCTGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000012416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017374.2-593s1c1
Sequence:CCGGGTAGCGTTAAAGGTGCGCTATCTCGAGATAGCGCACCTTTAACGCTACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000012413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017374.2-1628s1c1
Sequence:CCGGCCACTTCAATTCATAACCCTTCTCGAGAAGGGTTATGAATTGAAGTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000012414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017374.2-653s1c1
Sequence:CCGGCGGCAGATCACACAAGTGTATCTCGAGATACACTTGTGTGATCTGCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000012415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017374.2-1109s1c1
Sequence:CCGGGCTGCTATCATGGAATTAGATCTCGAGATCTAATTCCATGATAGCAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000012417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017374.2-870s1c1
Sequence:CCGGGCCCAATGTGTGATCTCTTATCTCGAGATAAGAGATCACACATTGGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017374
VALIDATED
PPP2CB MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, catalytic subunit, beta isozyme
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000294513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-874s21c1
Sequence:CCGGGCCCAATGTGTGATCTCTTATCTCGAGATAAGAGATCACACATTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-391s21c1
Sequence:CCGGGCGAGAAGGCTAAGGAAATTTCTCGAGAAATTTCCTTAGCCTTCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-356s21c1
Sequence:CCGGTAAGCAGCTGAACGAGAACCACTCGAGTGGTTCTCGTTCAGCTGCTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-347s21c1
Sequence:CCGGGAACGAGTGTAAGCAGCTGAACTCGAGTTCAGCTGCTTACACTCGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017374.3-657s21c1
Sequence:CCGGCGGCAGATCACACAAGTGTATCTCGAGATACACTTGTGTGATCTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017374.2-593s1c1
Sequence:CCGGGTAGCGTTAAAGGTGCGCTATCTCGAGATAGCGCACCTTTAACGCTACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017374.2-1628s1c1
Sequence:CCGGCCACTTCAATTCATAACCCTTCTCGAGAAGGGTTATGAATTGAAGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017374.2-653s1c1
Sequence:CCGGCGGCAGATCACACAAGTGTATCTCGAGATACACTTGTGTGATCTGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017374.2-1109s1c1
Sequence:CCGGGCTGCTATCATGGAATTAGATCTCGAGATCTAATTCCATGATAGCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017374.2-870s1c1
Sequence:CCGGGCCCAATGTGTGATCTCTTATCTCGAGATAAGAGATCACACATTGGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)