EMAIL THIS PAGE TO A FRIEND

PPP2R1A

protein phosphatase 2, regulatory subunit A, alpha

102 Gene Product Result for
Synonyms: PP2A-Aalpha PP2AAALPHA PR65A
UniProtKB ID: P30153, Q13773, Q6ICQ3, Q96DH3
Gene ID:
Human(5518) Summary: This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes an alpha isoform of the constant regulatory subunit A. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Mouse(51792) protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform
Rat(117281) protein phosphatase 2, regulatory subunit A, alpha
Zebrafish(406685) protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform
dog(484335) protein phosphatase 2, regulatory subunit A, alpha
cow(535321) protein phosphatase 2, regulatory subunit A, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C7632 Cantharidin human pricing
D6908 DL-erythro-Dihydrosphingosine ≥99%, synthetic human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014225 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014225 siRNAs that have been validated in the lab human pricing
NM_057140 Rosetta Predictions rat pricing
NM_016891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014225 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232389 validated 1072
2 SASI_Hs01_00232387 predicted 938
3 SASI_Hs01_00232388 predicted 1059
4 SASI_Hs02_00345252 predicted 555
5 SASI_Hs01_00232390 predicted 1735
6 SASI_Hs01_00232391 predicted 1282
7 SASI_Hs01_00232393 predicted 1820
8 SASI_Hs01_00232394 predicted 852
9 SASI_Hs01_00232395 predicted 1606
10 SASI_Hs02_00345253 predicted 964
11 SASI_Hs01_00232392 predicted 359
12 SASI_Hs01_00232396 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068506 predicted 366
2 SASI_Rn01_00068507 predicted 1498
3 SASI_Rn01_00068508 predicted 1446
4 SASI_Rn01_00068509 predicted 1819
5 SASI_Rn01_00068510 predicted 1062
6 SASI_Rn01_00068511 predicted 205
7 SASI_Rn01_00068512 predicted 1488
8 SASI_Rn02_00267092 predicted 1567
9 SASI_Rn02_00267093 predicted 466
10 SASI_Rn02_00267094 predicted 1053
11 SASI_Rn01_00068503 predicted 505
12 SASI_Rn01_00068504 predicted 616
13 SASI_Rn01_00068505 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110171 predicted 1667
2 SASI_Mm01_00110172 predicted 545
3 SASI_Mm01_00110173 predicted 658
4 SASI_Mm01_00110174 predicted 1862
5 SASI_Mm01_00110175 predicted 1619
6 SASI_Mm01_00110176 predicted 413
7 SASI_Mm01_00110177 predicted 1548
8 SASI_Mm01_00110178 predicted 1504
9 SASI_Mm01_00110180 predicted 1537
10 SASI_Mm02_00323723 predicted 252
11 SASI_Mm01_00110179 predicted 1026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014225
VALIDATED
PPP2R1A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit A, alpha
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014225.x-2203s1c1
Sequence:CCGGATTTACTTCTCCACCTCCCGTCTCGAGACGGGAGGTGGAGAAGTAAATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014225.x-1281s1c1
Sequence:CCGGGACTGTGTGAACGAGGTGATTCTCGAGAATCACCTCGTTCACACAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014225.4-1470s21c1
Sequence:GTACCGGGTTCTTTGATGAGAAACTTAACTCGAGTTAAGTTTCTCATCAAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014225.x-162s1c1
Sequence:CCGGCTCATAGACGAACTCCGCAATCTCGAGATTGCGGAGTTCGTCTATGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014225.x-1462s1c1
Sequence:CCGGCCTGGCTTGTGGATCATGTATCTCGAGATACATGATCCACAAGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014225.4-1325s21c1
Sequence:GTACCGGACTGTGTGAACGAGGTGATTGCTCGAGCAATCACCTCGTTCACACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014225.3-1714s21c1
Sequence:CCGGTTGCCAATGTCCGCTTCAATGCTCGAGCATTGAAGCGGACATTGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014225.4-1016s21c1
Sequence:GTACCGGCCTTCCAGAACCTGATGAAAGCTCGAGCTTTCATCAGGTTCTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014225.3-1825s21c1
Sequence:CCGGACCAGGATGTGGACGTCAAATCTCGAGATTTGACGTCCACATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014225.3-2167s21c1
Sequence:CCGGACTGGATCCTGCTGCTGTAATCTCGAGATTACAGCAGCAGGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014225.3-1615s21c1
Sequence:CCGGCTACGCTCTTCTGCATCAATGCTCGAGCATTGATGCAGAAGAGCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014225.3-1463s21c1
Sequence:CCGGCTGGCTTGTGGATCATGTATACTCGAGTATACATGATCCACAAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014225
VALIDATED
PPP2R1A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit A, alpha
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014225.x-2203s1c1
Sequence:CCGGATTTACTTCTCCACCTCCCGTCTCGAGACGGGAGGTGGAGAAGTAAATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014225.x-1281s1c1
Sequence:CCGGGACTGTGTGAACGAGGTGATTCTCGAGAATCACCTCGTTCACACAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014225.4-1470s21c1
Sequence:GTACCGGGTTCTTTGATGAGAAACTTAACTCGAGTTAAGTTTCTCATCAAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014225.x-162s1c1
Sequence:CCGGCTCATAGACGAACTCCGCAATCTCGAGATTGCGGAGTTCGTCTATGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014225.x-1462s1c1
Sequence:CCGGCCTGGCTTGTGGATCATGTATCTCGAGATACATGATCCACAAGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014225.4-1325s21c1
Sequence:GTACCGGACTGTGTGAACGAGGTGATTGCTCGAGCAATCACCTCGTTCACACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014225.3-1714s21c1
Sequence:CCGGTTGCCAATGTCCGCTTCAATGCTCGAGCATTGAAGCGGACATTGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014225.4-1016s21c1
Sequence:GTACCGGCCTTCCAGAACCTGATGAAAGCTCGAGCTTTCATCAGGTTCTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014225.3-1825s21c1
Sequence:CCGGACCAGGATGTGGACGTCAAATCTCGAGATTTGACGTCCACATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014225.3-2167s21c1
Sequence:CCGGACTGGATCCTGCTGCTGTAATCTCGAGATTACAGCAGCAGGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014225.3-1615s21c1
Sequence:CCGGCTACGCTCTTCTGCATCAATGCTCGAGCATTGATGCAGAAGAGCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014225.3-1463s21c1
Sequence:CCGGCTGGCTTGTGGATCATGTATACTCGAGTATACATGATCCACAAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014225
VALIDATED
PPP2R1A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit A, alpha
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014225.x-2203s1c1
Sequence:CCGGATTTACTTCTCCACCTCCCGTCTCGAGACGGGAGGTGGAGAAGTAAATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014225.x-1281s1c1
Sequence:CCGGGACTGTGTGAACGAGGTGATTCTCGAGAATCACCTCGTTCACACAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014225.4-1470s21c1
Sequence:GTACCGGGTTCTTTGATGAGAAACTTAACTCGAGTTAAGTTTCTCATCAAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014225.x-162s1c1
Sequence:CCGGCTCATAGACGAACTCCGCAATCTCGAGATTGCGGAGTTCGTCTATGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014225.x-1462s1c1
Sequence:CCGGCCTGGCTTGTGGATCATGTATCTCGAGATACATGATCCACAAGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014225.4-1325s21c1
Sequence:GTACCGGACTGTGTGAACGAGGTGATTGCTCGAGCAATCACCTCGTTCACACAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014225.3-1714s21c1
Sequence:CCGGTTGCCAATGTCCGCTTCAATGCTCGAGCATTGAAGCGGACATTGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014225.4-1016s21c1
Sequence:GTACCGGCCTTCCAGAACCTGATGAAAGCTCGAGCTTTCATCAGGTTCTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014225.3-1825s21c1
Sequence:CCGGACCAGGATGTGGACGTCAAATCTCGAGATTTGACGTCCACATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014225.3-2167s21c1
Sequence:CCGGACTGGATCCTGCTGCTGTAATCTCGAGATTACAGCAGCAGGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014225.3-1615s21c1
Sequence:CCGGCTACGCTCTTCTGCATCAATGCTCGAGCATTGATGCAGAAGAGCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014225.3-1463s21c1
Sequence:CCGGCTGGCTTGTGGATCATGTATACTCGAGTATACATGATCCACAAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016891
VALIDATED
PPP2R1A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit A, alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016891.2-268s1c1
Sequence:CCGGGCTGGGAACCTTCACAACTTTCTCGAGAAAGTTGTGAAGGTTCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016891.3-2063s21c1
Sequence:CCGGGGTTGTTCCTGCCCATATTGGCTCGAGCCAATATGGGCAGGAACAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016891.2-1540s1c1
Sequence:CCGGGCACCGAATGACTACACTCTTCTCGAGAAGAGTGTAGTCATTCGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016891.2-1436s1c1
Sequence:CCGGGCCACCAGCAACCTTAAGAAACTCGAGTTTCTTAAGGTTGCTGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016891.2-1870s1c1
Sequence:CCGGCCCACAAAGTTACCTCCCTTACTCGAGTAAGGGAGGTAACTTTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016891.2-82s1c1
Sequence:CCGGCTATCCTATTGCGGTGCTCATCTCGAGATGAGCACCGCAATAGGATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016891.3-1690s21c1
Sequence:GTACCGGGATAGGACCCATTCTTGATAACTCGAGTTATCAAGAATGGGTCCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016891.3-1767s21c1
Sequence:CCGGATGTGGATGTCAAGTACTTTGCTCGAGCAAAGTACTTGACATCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016891.3-651s21c1
Sequence:CCGGATGTCAAGAGTGAGATCATTCCTCGAGGAATGATCTCACTCTTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016891.3-123s21c1
Sequence:CCGGACGTTCAGCTTCGTCTCAATACTCGAGTATTGAGACGAAGCTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016891
VALIDATED
PPP2R1A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit A, alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016891.2-268s1c1
Sequence:CCGGGCTGGGAACCTTCACAACTTTCTCGAGAAAGTTGTGAAGGTTCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016891.3-2063s21c1
Sequence:CCGGGGTTGTTCCTGCCCATATTGGCTCGAGCCAATATGGGCAGGAACAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016891.2-1540s1c1
Sequence:CCGGGCACCGAATGACTACACTCTTCTCGAGAAGAGTGTAGTCATTCGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016891.2-1436s1c1
Sequence:CCGGGCCACCAGCAACCTTAAGAAACTCGAGTTTCTTAAGGTTGCTGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016891.2-1870s1c1
Sequence:CCGGCCCACAAAGTTACCTCCCTTACTCGAGTAAGGGAGGTAACTTTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016891.2-82s1c1
Sequence:CCGGCTATCCTATTGCGGTGCTCATCTCGAGATGAGCACCGCAATAGGATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016891.3-1690s21c1
Sequence:GTACCGGGATAGGACCCATTCTTGATAACTCGAGTTATCAAGAATGGGTCCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016891.3-1767s21c1
Sequence:CCGGATGTGGATGTCAAGTACTTTGCTCGAGCAAAGTACTTGACATCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016891.3-651s21c1
Sequence:CCGGATGTCAAGAGTGAGATCATTCCTCGAGGAATGATCTCACTCTTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016891.3-123s21c1
Sequence:CCGGACGTTCAGCTTCGTCTCAATACTCGAGTATTGAGACGAAGCTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016891
VALIDATED
PPP2R1A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit A, alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016891.2-268s1c1
Sequence:CCGGGCTGGGAACCTTCACAACTTTCTCGAGAAAGTTGTGAAGGTTCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016891.3-2063s21c1
Sequence:CCGGGGTTGTTCCTGCCCATATTGGCTCGAGCCAATATGGGCAGGAACAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016891.2-1540s1c1
Sequence:CCGGGCACCGAATGACTACACTCTTCTCGAGAAGAGTGTAGTCATTCGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016891.2-1436s1c1
Sequence:CCGGGCCACCAGCAACCTTAAGAAACTCGAGTTTCTTAAGGTTGCTGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016891.2-1870s1c1
Sequence:CCGGCCCACAAAGTTACCTCCCTTACTCGAGTAAGGGAGGTAACTTTGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016891.2-82s1c1
Sequence:CCGGCTATCCTATTGCGGTGCTCATCTCGAGATGAGCACCGCAATAGGATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016891.3-1690s21c1
Sequence:GTACCGGGATAGGACCCATTCTTGATAACTCGAGTTATCAAGAATGGGTCCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016891.3-1767s21c1
Sequence:CCGGATGTGGATGTCAAGTACTTTGCTCGAGCAAAGTACTTGACATCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016891.3-651s21c1
Sequence:CCGGATGTCAAGAGTGAGATCATTCCTCGAGGAATGATCTCACTCTTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016891.3-123s21c1
Sequence:CCGGACGTTCAGCTTCGTCTCAATACTCGAGTATTGAGACGAAGCTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)