EMAIL THIS PAGE TO A FRIEND

PPP2R1B

protein phosphatase 2, regulatory subunit A, beta

172 Gene Product Result for
Synonyms: PP2A-Abeta PR65B
Gene ID:
Human(5519) Summary: This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes a beta isoform of the constant regulatory subunit A. Mutations in this gene have been associated with some lung and colon cancers. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Mouse(73699) protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform
Rat(315648) protein phosphatase 2, regulatory subunit A, beta
cow(282460) protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform
cow(100138150) protein phosphatase 2, regulatory subunit A, beta
sheep(101108511) protein phosphatase 2, regulatory subunit A, beta
domestic guinea pig(100713478) protein phosphatase 2, regulatory subunit A, beta
naked mole-rat(101722244) protein phosphatase 2, regulatory subunit A, beta
Zebrafish(449548) protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform
chicken(777130) protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform
domestic cat(101081075) protein phosphatase 2, regulatory subunit A, beta
dog(479444) protein phosphatase 2, regulatory subunit A, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C7632 Cantharidin human pricing
D6908 DL-erythro-Dihydrosphingosine ≥99%, synthetic human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002716 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_284491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002716 Rosetta Predictions human pricing
NM_181699 Rosetta Predictions human pricing
NM_001025418 Rosetta Predictions rat pricing
NM_001034085 Rosetta Predictions mouse pricing
NM_028614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040968 predicted 1593
2 SASI_Hs01_00040969 predicted 896
3 SASI_Hs01_00040970 predicted 703
4 SASI_Hs01_00040971 predicted 834
5 SASI_Hs02_00334306 predicted 1591
6 SASI_Hs01_00040972 predicted 455
7 SASI_Hs01_00040973 predicted 1197
8 SASI_Hs01_00040974 predicted 1572
9 SASI_Hs01_00040975 predicted 1515
10 SASI_Hs01_00040976 predicted 1470
11 SASI_Hs01_00040967 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195634 predicted 1590
2 SASI_Hs01_00195635 predicted 896
3 SASI_Hs01_00195636 predicted 702
4 SASI_Hs01_00195637 predicted 840
5 SASI_Hs02_00370298 predicted 1586
6 SASI_Hs01_00195638 predicted 459
7 SASI_Hs01_00195639 predicted 1200
8 SASI_Hs01_00195640 predicted 1577
9 SASI_Hs01_00195641 predicted 1511
10 SASI_Hs01_00195642 predicted 1477
11 SASI_Hs01_00195633 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081165 predicted 1430
2 SASI_Rn01_00081166 predicted 842
3 SASI_Rn01_00081167 predicted 617
4 SASI_Rn01_00081168 predicted 1414
5 SASI_Rn01_00081169 predicted 509
6 SASI_Rn01_00081170 predicted 642
7 SASI_Rn01_00081171 predicted 1849
8 SASI_Rn01_00081172 predicted 705
9 SASI_Rn01_00081173 predicted 1511
10 SASI_Rn01_00081174 predicted 1656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086121 predicted 1480
2 SASI_Mm01_00086122 predicted 1060
3 SASI_Mm01_00086123 predicted 687
4 SASI_Mm01_00086124 predicted 1082
5 SASI_Mm02_00289091 predicted 1777
6 SASI_Mm01_00086125 predicted 711
7 SASI_Mm02_00289092 predicted 1955
8 SASI_Mm01_00086127 predicted 1596
9 SASI_Mm01_00086128 predicted 1027
10 SASI_Mm01_00086129 predicted 1007
11 SASI_Mm01_00086126 predicted 673
12 SASI_Mm01_00086130 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114890 predicted 1473
2 SASI_Mm01_00114891 predicted 1061
3 SASI_Mm01_00114892 predicted 690
4 SASI_Mm01_00114893 predicted 1084
5 SASI_Mm02_00334109 predicted 1558
6 SASI_Mm01_00114894 predicted 706
7 SASI_Mm01_00114895 predicted 669
8 SASI_Mm01_00114896 predicted 1592
9 SASI_Mm01_00114897 predicted 1026
10 SASI_Mm01_00114898 predicted 1011
11 SASI_Mm01_00114899 predicted 1164
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028614
VALIDATED
PPP2R1B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit A, beta
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028614.2-1584s21c1
Sequence:CCGGACCACGCTCTTCTGCATTAATCTCGAGATTAATGCAGAAGAGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-2231s21c1
Sequence:CCGGAGTGGAGTGAATCCCTTATTGCTCGAGCAATAAGGGATTCACTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-1838s21c1
Sequence:CCGGTGTTCTTGCCTTGGCATAAAGCTCGAGCTTTATGCCAAGGCAAGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-2320s21c1
Sequence:CCGGATATCTGCTTGGAGCTAATATCTCGAGATATTAGCTCCAAGCAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-1214s21c1
Sequence:CCGGGTGTCCAGAAGTTCGTTTAAACTCGAGTTTAAACGAACTTCTGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-701s21c1
Sequence:CCGGTGTCCCATTGTTCACGAATTTCTCGAGAAATTCGTGAACAATGGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-1057s21c1
Sequence:CCGGATCAAATCCTGCCCTATATAACTCGAGTTATATAGGGCAGGATTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028614
VALIDATED
PPP2R1B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit A, beta
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028614.2-1584s21c1
Sequence:CCGGACCACGCTCTTCTGCATTAATCTCGAGATTAATGCAGAAGAGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-2231s21c1
Sequence:CCGGAGTGGAGTGAATCCCTTATTGCTCGAGCAATAAGGGATTCACTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-1838s21c1
Sequence:CCGGTGTTCTTGCCTTGGCATAAAGCTCGAGCTTTATGCCAAGGCAAGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-2320s21c1
Sequence:CCGGATATCTGCTTGGAGCTAATATCTCGAGATATTAGCTCCAAGCAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-1214s21c1
Sequence:CCGGGTGTCCAGAAGTTCGTTTAAACTCGAGTTTAAACGAACTTCTGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-701s21c1
Sequence:CCGGTGTCCCATTGTTCACGAATTTCTCGAGAAATTCGTGAACAATGGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-1057s21c1
Sequence:CCGGATCAAATCCTGCCCTATATAACTCGAGTTATATAGGGCAGGATTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028614
VALIDATED
PPP2R1B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit A, beta
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028614.2-1584s21c1
Sequence:CCGGACCACGCTCTTCTGCATTAATCTCGAGATTAATGCAGAAGAGCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-2231s21c1
Sequence:CCGGAGTGGAGTGAATCCCTTATTGCTCGAGCAATAAGGGATTCACTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-1838s21c1
Sequence:CCGGTGTTCTTGCCTTGGCATAAAGCTCGAGCTTTATGCCAAGGCAAGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-2320s21c1
Sequence:CCGGATATCTGCTTGGAGCTAATATCTCGAGATATTAGCTCCAAGCAGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-1214s21c1
Sequence:CCGGGTGTCCAGAAGTTCGTTTAAACTCGAGTTTAAACGAACTTCTGGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-701s21c1
Sequence:CCGGTGTCCCATTGTTCACGAATTTCTCGAGAAATTCGTGAACAATGGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028614.2-1057s21c1
Sequence:CCGGATCAAATCCTGCCCTATATAACTCGAGTTATATAGGGCAGGATTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002716
VALIDATED
PPP2R1B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit A, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002716.4-300s21c1
Sequence:CCGGTGATGAAGATGAGGTACTATTCTCGAGAATAGTACCTCATCTTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002716.4-580s21c1
Sequence:CCGGTGCTATCCCAGGGCATCAAATCTCGAGATTTGATGCCCTGGGATAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002716.4-885s21c1
Sequence:CCGGATCTTGGCGCGTTCGCTATATCTCGAGATATAGCGAACGCGCCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002716.4-804s21c1
Sequence:CCGGTGTCAGTATTGCCCAGTTATTCTCGAGAATAACTGGGCAATACTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002716.4-2703s21c1
Sequence:CCGGCTAAGAACCACAGGGATAATACTCGAGTATTATCCCTGTGGTTCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002716.x-1598s1c1
Sequence:CCGGTGACCACTTTATTCTGCATTACTCGAGTAATGCAGAATAAAGTGGTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002716.x-242s1c1
Sequence:CCGGCCCGAAGTGAATTGTTGCCATCTCGAGATGGCAACAATTCACTTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002716.x-5497s1c1
Sequence:CCGGCGGAGGACGAATAGAGTTTAACTCGAGTTAAACTCTATTCGTCCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002716.x-796s1c1
Sequence:CCGGGCCCAGTTATTGTCTCAGGATCTCGAGATCCTGAGACAATAACTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_002716.x-1486s1c1
Sequence:CCGGGCCACCAACAACCTCATGAAACTCGAGTTTCATGAGGTTGTTGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002716
VALIDATED
PPP2R1B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit A, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002716.4-300s21c1
Sequence:CCGGTGATGAAGATGAGGTACTATTCTCGAGAATAGTACCTCATCTTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002716.4-580s21c1
Sequence:CCGGTGCTATCCCAGGGCATCAAATCTCGAGATTTGATGCCCTGGGATAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002716.4-885s21c1
Sequence:CCGGATCTTGGCGCGTTCGCTATATCTCGAGATATAGCGAACGCGCCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002716.4-804s21c1
Sequence:CCGGTGTCAGTATTGCCCAGTTATTCTCGAGAATAACTGGGCAATACTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002716.4-2703s21c1
Sequence:CCGGCTAAGAACCACAGGGATAATACTCGAGTATTATCCCTGTGGTTCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002716.x-1598s1c1
Sequence:CCGGTGACCACTTTATTCTGCATTACTCGAGTAATGCAGAATAAAGTGGTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002716.x-242s1c1
Sequence:CCGGCCCGAAGTGAATTGTTGCCATCTCGAGATGGCAACAATTCACTTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002716.x-5497s1c1
Sequence:CCGGCGGAGGACGAATAGAGTTTAACTCGAGTTAAACTCTATTCGTCCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002716.x-796s1c1
Sequence:CCGGGCCCAGTTATTGTCTCAGGATCTCGAGATCCTGAGACAATAACTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_002716.x-1486s1c1
Sequence:CCGGGCCACCAACAACCTCATGAAACTCGAGTTTCATGAGGTTGTTGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002716
VALIDATED
PPP2R1B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit A, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002716.4-300s21c1
Sequence:CCGGTGATGAAGATGAGGTACTATTCTCGAGAATAGTACCTCATCTTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002716.4-580s21c1
Sequence:CCGGTGCTATCCCAGGGCATCAAATCTCGAGATTTGATGCCCTGGGATAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002716.4-885s21c1
Sequence:CCGGATCTTGGCGCGTTCGCTATATCTCGAGATATAGCGAACGCGCCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002716.4-804s21c1
Sequence:CCGGTGTCAGTATTGCCCAGTTATTCTCGAGAATAACTGGGCAATACTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002716.4-2703s21c1
Sequence:CCGGCTAAGAACCACAGGGATAATACTCGAGTATTATCCCTGTGGTTCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002716.x-1598s1c1
Sequence:CCGGTGACCACTTTATTCTGCATTACTCGAGTAATGCAGAATAAAGTGGTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002716.x-242s1c1
Sequence:CCGGCCCGAAGTGAATTGTTGCCATCTCGAGATGGCAACAATTCACTTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002716.x-5497s1c1
Sequence:CCGGCGGAGGACGAATAGAGTTTAACTCGAGTTAAACTCTATTCGTCCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002716.x-796s1c1
Sequence:CCGGGCCCAGTTATTGTCTCAGGATCTCGAGATCCTGAGACAATAACTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_002716.x-1486s1c1
Sequence:CCGGGCCACCAACAACCTCATGAAACTCGAGTTTCATGAGGTTGTTGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284491
VALIDATED
PPP2R1B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit A, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284491.4-1764s1c1
Sequence:CCGGCCAGAATACCATTGTCCCTAACTCGAGTTAGGGACAATGGTATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284491.4-546s1c1
Sequence:CCGGGCTGGGAAATTTCACTGGTTTCTCGAGAAACCAGTGAAATTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_284491.4-1806s1c1
Sequence:CCGGCCCTAACTACTTACACAGAATCTCGAGATTCTGTGTAAGTAGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284491.4-1238s1c1
Sequence:CCGGCCCACAAAGTAAGAGAGCTTTCTCGAGAAAGCTCTCTTACTTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284491.4-408s1c1
Sequence:CCGGGCTCCGTCTCAACAGTATTAACTCGAGTTAATACTGTTGAGACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284491
VALIDATED
PPP2R1B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit A, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284491.4-1764s1c1
Sequence:CCGGCCAGAATACCATTGTCCCTAACTCGAGTTAGGGACAATGGTATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284491.4-546s1c1
Sequence:CCGGGCTGGGAAATTTCACTGGTTTCTCGAGAAACCAGTGAAATTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_284491.4-1806s1c1
Sequence:CCGGCCCTAACTACTTACACAGAATCTCGAGATTCTGTGTAAGTAGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284491.4-1238s1c1
Sequence:CCGGCCCACAAAGTAAGAGAGCTTTCTCGAGAAAGCTCTCTTACTTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284491.4-408s1c1
Sequence:CCGGGCTCCGTCTCAACAGTATTAACTCGAGTTAATACTGTTGAGACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284491
VALIDATED
PPP2R1B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit A, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284491.4-1764s1c1
Sequence:CCGGCCAGAATACCATTGTCCCTAACTCGAGTTAGGGACAATGGTATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284491.4-546s1c1
Sequence:CCGGGCTGGGAAATTTCACTGGTTTCTCGAGAAACCAGTGAAATTTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_284491.4-1806s1c1
Sequence:CCGGCCCTAACTACTTACACAGAATCTCGAGATTCTGTGTAAGTAGTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284491.4-1238s1c1
Sequence:CCGGCCCACAAAGTAAGAGAGCTTTCTCGAGAAAGCTCTCTTACTTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284491.4-408s1c1
Sequence:CCGGGCTCCGTCTCAACAGTATTAACTCGAGTTAATACTGTTGAGACGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)