EMAIL THIS PAGE TO A FRIEND

PPP2R2A

protein phosphatase 2, regulatory subunit B, alpha

126 Gene Product Result for
Synonyms: B55A B55ALPHA PR52A PR55A
UniProtKB ID: P63151, B2RBU8, B4E1T7, P50409, Q00007
Gene ID:
Human(5520) Summary: The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Mouse(71978) protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform
Rat(117104) protein phosphatase 2, regulatory subunit B, alpha
Zebrafish(558752) protein phosphatase 2, regulatory subunit B, alpha
Horse(100059955) protein phosphatase 2, regulatory subunit B, alpha
domestic cat(101099546) protein phosphatase 2, regulatory subunit B, alpha
dog(477374) protein phosphatase 2, regulatory subunit B, alpha
chicken(419523) protein phosphatase 2, regulatory subunit B, alpha
naked mole-rat(101708645) protein phosphatase 2, regulatory subunit B, alpha
domestic guinea pig(100733570) protein phosphatase 2, regulatory subunit B, alpha
cow(508045) protein phosphatase 2, regulatory subunit B, alpha
sheep(101110299) protein phosphatase 2, regulatory subunit B, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C7632 Cantharidin human pricing
D6908 DL-erythro-Dihydrosphingosine ≥99%, synthetic human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002717 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002717 siRNAs that have been validated in the lab human pricing
NM_053999 Rosetta Predictions rat pricing
NM_028032 Rosetta Predictions mouse pricing
XM_001003559 Rosetta Predictions mouse pricing
XM_001003561 Rosetta Predictions mouse pricing
XM_619260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002717 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125876 validated 1678
1 SASI_Hs01_00125874 validated 720
1 SASI_Hs01_00125875 validated 1091
2 SASI_Hs02_00334307 predicted 1431
3 SASI_Hs01_00125877 predicted 728
4 SASI_Hs01_00125878 predicted 1042
5 SASI_Hs02_00334308 predicted 832
6 SASI_Hs02_00334309 predicted 1522
7 SASI_Hs01_00125880 predicted 1349
8 SASI_Hs01_00125881 predicted 963
9 SASI_Hs01_00125882 predicted 1634
10 SASI_Hs01_00125879 predicted 955
11 SASI_Hs01_00125883 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031299 predicted 1272
2 SASI_Rn01_00031300 predicted 1140
3 SASI_Rn01_00031301 predicted 1603
4 SASI_Rn01_00031302 predicted 1158
5 SASI_Rn01_00031303 predicted 1262
6 SASI_Rn01_00031304 predicted 1449
7 SASI_Rn01_00031305 predicted 1191
8 SASI_Rn01_00031306 predicted 739
9 SASI_Rn01_00031307 predicted 1214
10 SASI_Rn01_00031308 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333175 predicted 1289
2 SASI_Mm02_00333176 predicted 1312
3 SASI_Mm02_00333177 predicted 792
4 SASI_Mm02_00333178 predicted 858
5 SASI_Mm02_00333179 predicted 1072
6 SASI_Mm02_00333180 predicted 1172
7 SASI_Mm02_00333181 predicted 747
8 SASI_Mm02_00333182 predicted 1222
9 SASI_Mm02_00333183 predicted 947
10 SASI_Mm02_00333184 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236785 predicted 393
2 SASI_Mm01_00236786 predicted 790
3 SASI_Mm01_00236787 predicted 763
4 SASI_Mm01_00236788 predicted 790
5 SASI_Mm01_00236789 predicted 455
6 SASI_Mm01_00236790 predicted 398
7 SASI_Mm01_00236791 predicted 455
8 SASI_Mm01_00236792 predicted 450
9 SASI_Mm01_00236793 predicted 424
10 SASI_Mm01_00236794 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252700 predicted 398
2 SASI_Mm01_00252701 predicted 837
3 SASI_Mm01_00252702 predicted 900
4 SASI_Mm01_00252703 predicted 1116
5 SASI_Mm01_00252704 predicted 797
6 SASI_Mm01_00252705 predicted 994
7 SASI_Mm01_00252706 predicted 931
8 SASI_Mm01_00252707 predicted 916
9 SASI_Mm01_00252708 predicted 976
10 SASI_Mm01_00252709 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207830 predicted 1337
2 SASI_Mm01_00207831 predicted 392
3 SASI_Mm01_00207832 predicted 1359
4 SASI_Mm01_00207833 predicted 837
5 SASI_Mm01_00207834 predicted 905
6 SASI_Mm01_00207835 predicted 1124
7 SASI_Mm01_00207836 predicted 1224
8 SASI_Mm01_00207837 predicted 1498
9 SASI_Mm01_00207838 predicted 1272
10 SASI_Mm01_00207839 predicted 989
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002717
VALIDATED
PPP2R2A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B, alpha
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002717.x-1413s1c1
Sequence:CCGGAGAAACACAAAGCGAGACATACTCGAGTATGTCTCGCTTTGTGTTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002717.x-1676s1c1
Sequence:CCGGTCCTGCTTAGTTGAGATAGTTCTCGAGAACTATCTCAACTAAGCAGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002717.x-363s1c1
Sequence:CCGGGTAGATGATGATGTAGCAGAACTCGAGTTCTGCTACATCATCATCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002717.x-1122s1c1
Sequence:CCGGGATCCCAGTAACAGGTCATTTCTCGAGAAATGACCTGTTACTGGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002717.x-1497s1c1
Sequence:CCGGGCAAGTGGCAAGCGAAAGAAACTCGAGTTTCTTTCGCTTGCCACTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002717.2-770s21c1
Sequence:GTACCGGCTTTAGGCCTATGGATCTAATCTCGAGATTAGATCCATAGGCCTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002717.2-885s21c1
Sequence:GTACCGGGCAGATGATTTGCGGATTAATCTCGAGATTAATCCGCAAATCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002717
VALIDATED
PPP2R2A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B, alpha
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002717.x-1413s1c1
Sequence:CCGGAGAAACACAAAGCGAGACATACTCGAGTATGTCTCGCTTTGTGTTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002717.x-1676s1c1
Sequence:CCGGTCCTGCTTAGTTGAGATAGTTCTCGAGAACTATCTCAACTAAGCAGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002717.x-363s1c1
Sequence:CCGGGTAGATGATGATGTAGCAGAACTCGAGTTCTGCTACATCATCATCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002717.x-1122s1c1
Sequence:CCGGGATCCCAGTAACAGGTCATTTCTCGAGAAATGACCTGTTACTGGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002717.x-1497s1c1
Sequence:CCGGGCAAGTGGCAAGCGAAAGAAACTCGAGTTTCTTTCGCTTGCCACTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002717.2-770s21c1
Sequence:GTACCGGCTTTAGGCCTATGGATCTAATCTCGAGATTAGATCCATAGGCCTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002717.2-885s21c1
Sequence:GTACCGGGCAGATGATTTGCGGATTAATCTCGAGATTAATCCGCAAATCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002717
VALIDATED
PPP2R2A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B, alpha
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002717.x-1413s1c1
Sequence:CCGGAGAAACACAAAGCGAGACATACTCGAGTATGTCTCGCTTTGTGTTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002717.x-1676s1c1
Sequence:CCGGTCCTGCTTAGTTGAGATAGTTCTCGAGAACTATCTCAACTAAGCAGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002717.x-363s1c1
Sequence:CCGGGTAGATGATGATGTAGCAGAACTCGAGTTCTGCTACATCATCATCTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002717.x-1122s1c1
Sequence:CCGGGATCCCAGTAACAGGTCATTTCTCGAGAAATGACCTGTTACTGGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002717.x-1497s1c1
Sequence:CCGGGCAAGTGGCAAGCGAAAGAAACTCGAGTTTCTTTCGCTTGCCACTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002717.2-770s21c1
Sequence:GTACCGGCTTTAGGCCTATGGATCTAATCTCGAGATTAGATCCATAGGCCTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002717.2-885s21c1
Sequence:GTACCGGGCAGATGATTTGCGGATTAATCTCGAGATTAATCCGCAAATCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028032
VALIDATED
PPP2R2A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028032.2-404s21c1
Sequence:CCGGACGTAGCAGAAGCAGATATAACTCGAGTTATATCTGCTTCTGCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028032.2-893s21c1
Sequence:CCGGGTGATTATGAAACCTACTTATCTCGAGATAAGTAGGTTTCATAATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028032.2-916s21c1
Sequence:CCGGGCAGATGATTTGCGAATTAATCTCGAGATTAATTCGCAAATCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028032.2-801s21c1
Sequence:CCGGATTTAGGCCCATGGATCTAATCTCGAGATTAGATCCATGGGCCTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028032.2-2182s21c1
Sequence:CCGGTTGTCTCGGTGGTGGCGTATTCTCGAGAATACGCCACCACCGAGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028032
VALIDATED
PPP2R2A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028032.2-404s21c1
Sequence:CCGGACGTAGCAGAAGCAGATATAACTCGAGTTATATCTGCTTCTGCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028032.2-893s21c1
Sequence:CCGGGTGATTATGAAACCTACTTATCTCGAGATAAGTAGGTTTCATAATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028032.2-916s21c1
Sequence:CCGGGCAGATGATTTGCGAATTAATCTCGAGATTAATTCGCAAATCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028032.2-801s21c1
Sequence:CCGGATTTAGGCCCATGGATCTAATCTCGAGATTAGATCCATGGGCCTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028032.2-2182s21c1
Sequence:CCGGTTGTCTCGGTGGTGGCGTATTCTCGAGAATACGCCACCACCGAGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028032
VALIDATED
PPP2R2A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028032.2-404s21c1
Sequence:CCGGACGTAGCAGAAGCAGATATAACTCGAGTTATATCTGCTTCTGCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028032.2-893s21c1
Sequence:CCGGGTGATTATGAAACCTACTTATCTCGAGATAAGTAGGTTTCATAATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028032.2-916s21c1
Sequence:CCGGGCAGATGATTTGCGAATTAATCTCGAGATTAATTCGCAAATCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028032.2-801s21c1
Sequence:CCGGATTTAGGCCCATGGATCTAATCTCGAGATTAGATCCATGGGCCTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028032.2-2182s21c1
Sequence:CCGGTTGTCTCGGTGGTGGCGTATTCTCGAGAATACGCCACCACCGAGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)