EMAIL THIS PAGE TO A FRIEND

PPP2R2C

protein phosphatase 2, regulatory subunit B, gamma

129 Gene Product Result for
Synonyms: B55-GAMMA IMYPNO IMYPNO1 PR52 PR55G
UniProtKB ID: Q9Y2T4, A8MSY7, B7Z3Y1, Q7Z4V7, Q8NEC4, Q9H3G7
Gene ID:
Human(5522) Summary: The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(269643) protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform
Rat(117256) protein phosphatase 2, regulatory subunit B, gamma
Zebrafish(100002802) protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform
Horse(100070133) protein phosphatase 2, regulatory subunit B, gamma
domestic cat(101091784) protein phosphatase 2, regulatory subunit B, gamma
dog(610262) protein phosphatase 2, regulatory subunit B, gamma
chicken(422858) protein phosphatase 2, regulatory subunit B, gamma
naked mole-rat(101711517) protein phosphatase 2, regulatory subunit B, gamma
domestic guinea pig(100730883) protein phosphatase 2, regulatory subunit B, gamma
cow(782110) protein phosphatase 2, regulatory subunit B, gamma
sheep(101102148) protein phosphatase 2, regulatory subunit B, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C7632 Cantharidin human pricing
D6908 DL-erythro-Dihydrosphingosine ≥99%, synthetic human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172994 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172994 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172994 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181876 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020416 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020416 Rosetta Predictions human pricing
NM_181876 Rosetta Predictions human pricing
NM_057116 Rosetta Predictions rat pricing
NM_172994 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070843 predicted 1662
2 SASI_Hs01_00070844 predicted 1693
3 SASI_Hs01_00070845 predicted 1699
4 SASI_Hs01_00070846 predicted 752
5 SASI_Hs01_00070847 predicted 1571
6 SASI_Hs01_00070848 predicted 723
7 SASI_Hs01_00070849 predicted 881
8 SASI_Hs01_00070850 predicted 1298
9 SASI_Hs01_00070851 predicted 1357
10 SASI_Hs01_00070852 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247454 predicted 1313
2 SASI_Hs01_00247455 predicted 1346
3 SASI_Hs01_00247456 predicted 1355
4 SASI_Hs01_00247457 predicted 403
5 SASI_Hs01_00247458 predicted 1219
6 SASI_Hs01_00247459 predicted 369
7 SASI_Hs01_00247460 predicted 536
8 SASI_Hs01_00247461 predicted 951
9 SASI_Hs01_00247462 predicted 1014
10 SASI_Hs01_00247463 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122377 predicted 880
2 SASI_Rn01_00122378 predicted 971
3 SASI_Rn01_00122379 predicted 461
4 SASI_Rn01_00122380 predicted 774
5 SASI_Rn01_00122381 predicted 1073
6 SASI_Rn01_00122382 predicted 531
7 SASI_Rn01_00122383 predicted 578
8 SASI_Rn01_00122384 predicted 692
9 SASI_Rn01_00122385 predicted 344
10 SASI_Rn01_00122386 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143594 predicted 1545
2 SASI_Mm01_00143595 predicted 603
3 SASI_Mm01_00143596 predicted 1140
4 SASI_Mm01_00143597 predicted 1687
5 SASI_Mm01_00143598 predicted 1229
6 SASI_Mm01_00143599 predicted 1122
7 SASI_Mm01_00143600 predicted 1549
8 SASI_Mm01_00143601 predicted 735
9 SASI_Mm01_00143602 predicted 1515
10 SASI_Mm01_00143603 predicted 1689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172994
PPP2R2C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B, gamma
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172994.2-3251s1c1
Sequence:CCGGCCCTCTTGTAAAGAAGTTGAACTCGAGTTCAACTTCTTTACAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172994.2-864s1c1
Sequence:CCGGGATCGGAGCTTCAACATTGTACTCGAGTACAATGTTGAAGCTCCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172994.2-1271s1c1
Sequence:CCGGCAAGTTTGAGTGTGCCTGGAACTCGAGTTCCAGGCACACTCAAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172994.2-1518s1c1
Sequence:CCGGGCTGAGAATATCATTGCCATTCTCGAGAATGGCAATGATATTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172994.2-440s1c1
Sequence:CCGGCCAGGGTGAGTACGATGTATACTCGAGTATACATCGTACTCACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172994
PPP2R2C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B, gamma
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172994.2-3251s1c1
Sequence:CCGGCCCTCTTGTAAAGAAGTTGAACTCGAGTTCAACTTCTTTACAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172994.2-864s1c1
Sequence:CCGGGATCGGAGCTTCAACATTGTACTCGAGTACAATGTTGAAGCTCCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172994.2-1271s1c1
Sequence:CCGGCAAGTTTGAGTGTGCCTGGAACTCGAGTTCCAGGCACACTCAAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172994.2-1518s1c1
Sequence:CCGGGCTGAGAATATCATTGCCATTCTCGAGAATGGCAATGATATTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172994.2-440s1c1
Sequence:CCGGCCAGGGTGAGTACGATGTATACTCGAGTATACATCGTACTCACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172994
PPP2R2C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B, gamma
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172994.2-3251s1c1
Sequence:CCGGCCCTCTTGTAAAGAAGTTGAACTCGAGTTCAACTTCTTTACAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172994.2-864s1c1
Sequence:CCGGGATCGGAGCTTCAACATTGTACTCGAGTACAATGTTGAAGCTCCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172994.2-1271s1c1
Sequence:CCGGCAAGTTTGAGTGTGCCTGGAACTCGAGTTCCAGGCACACTCAAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172994.2-1518s1c1
Sequence:CCGGGCTGAGAATATCATTGCCATTCTCGAGAATGGCAATGATATTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172994.2-440s1c1
Sequence:CCGGCCAGGGTGAGTACGATGTATACTCGAGTATACATCGTACTCACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181876
VALIDATED
PPP2R2C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B, gamma
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_181876.1-298s1c1
Sequence:CCGGTATCTCAAGAGCCTGGAGATACTCGAGTATCTCCAGGCTCTTGAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181876.2-843s21c1
Sequence:CCGGCCGCTCATTCTTCTCGGAAATCTCGAGATTTCCGAGAAGAATGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181876.2-1018s21c1
Sequence:CCGGCTGTACGAGAACGACTGCATTCTCGAGAATGCAGTCGTTCTCGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181876.2-255s21c1
Sequence:CCGGGCCGGAGTTTGACTATCTCAACTCGAGTTGAGATAGTCAAACTCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181876.2-94s21c1
Sequence:CCGGGCTGACATCATCTCTACCGTTCTCGAGAACGGTAGAGATGATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181876
VALIDATED
PPP2R2C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B, gamma
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_181876.1-298s1c1
Sequence:CCGGTATCTCAAGAGCCTGGAGATACTCGAGTATCTCCAGGCTCTTGAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181876.2-843s21c1
Sequence:CCGGCCGCTCATTCTTCTCGGAAATCTCGAGATTTCCGAGAAGAATGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181876.2-1018s21c1
Sequence:CCGGCTGTACGAGAACGACTGCATTCTCGAGAATGCAGTCGTTCTCGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181876.2-255s21c1
Sequence:CCGGGCCGGAGTTTGACTATCTCAACTCGAGTTGAGATAGTCAAACTCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181876.2-94s21c1
Sequence:CCGGGCTGACATCATCTCTACCGTTCTCGAGAACGGTAGAGATGATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181876
VALIDATED
PPP2R2C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B, gamma
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_181876.1-298s1c1
Sequence:CCGGTATCTCAAGAGCCTGGAGATACTCGAGTATCTCCAGGCTCTTGAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181876.2-843s21c1
Sequence:CCGGCCGCTCATTCTTCTCGGAAATCTCGAGATTTCCGAGAAGAATGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181876.2-1018s21c1
Sequence:CCGGCTGTACGAGAACGACTGCATTCTCGAGAATGCAGTCGTTCTCGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181876.2-255s21c1
Sequence:CCGGGCCGGAGTTTGACTATCTCAACTCGAGTTGAGATAGTCAAACTCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181876.2-94s21c1
Sequence:CCGGGCTGACATCATCTCTACCGTTCTCGAGAACGGTAGAGATGATGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020416
VALIDATED
PPP2R2C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B, gamma
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_020416.2-873s1c1
Sequence:CCGGCCGCTCATTCTTCTCGGAAATCTCGAGATTTCCGAGAAGAATGAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020416.2-124s1c1
Sequence:CCGGGCTGACATCATCTCTACCGTTCTCGAGAACGGTAGAGATGATGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020416.2-3315s1c1
Sequence:CCGGCCTTGTAAAGAGGTTCGAGAACTCGAGTTCTCGAACCTCTTTACAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020416.2-1048s1c1
Sequence:CCGGCTGTACGAGAACGACTGCATTCTCGAGAATGCAGTCGTTCTCGTACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020416.2-285s1c1
Sequence:CCGGGCCGGAGTTTGACTATCTCAACTCGAGTTGAGATAGTCAAACTCCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020416
VALIDATED
PPP2R2C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B, gamma
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_020416.2-873s1c1
Sequence:CCGGCCGCTCATTCTTCTCGGAAATCTCGAGATTTCCGAGAAGAATGAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020416.2-124s1c1
Sequence:CCGGGCTGACATCATCTCTACCGTTCTCGAGAACGGTAGAGATGATGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020416.2-3315s1c1
Sequence:CCGGCCTTGTAAAGAGGTTCGAGAACTCGAGTTCTCGAACCTCTTTACAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020416.2-1048s1c1
Sequence:CCGGCTGTACGAGAACGACTGCATTCTCGAGAATGCAGTCGTTCTCGTACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020416.2-285s1c1
Sequence:CCGGGCCGGAGTTTGACTATCTCAACTCGAGTTGAGATAGTCAAACTCCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020416
VALIDATED
PPP2R2C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B, gamma
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_020416.2-873s1c1
Sequence:CCGGCCGCTCATTCTTCTCGGAAATCTCGAGATTTCCGAGAAGAATGAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020416.2-124s1c1
Sequence:CCGGGCTGACATCATCTCTACCGTTCTCGAGAACGGTAGAGATGATGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020416.2-3315s1c1
Sequence:CCGGCCTTGTAAAGAGGTTCGAGAACTCGAGTTCTCGAACCTCTTTACAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020416.2-1048s1c1
Sequence:CCGGCTGTACGAGAACGACTGCATTCTCGAGAATGCAGTCGTTCTCGTACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020416.2-285s1c1
Sequence:CCGGGCCGGAGTTTGACTATCTCAACTCGAGTTGAGATAGTCAAACTCCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)