EMAIL THIS PAGE TO A FRIEND

PPP2R2D

protein phosphatase 2, regulatory subunit B, delta

79 Gene Product Result for
Synonyms: MDS026
UniProtKB ID: Q66LE6, A8KAK0, Q5SQJ2, Q9P1Y7
Gene ID:
Mouse(52432) protein phosphatase 2, regulatory subunit B, delta isoform
Rat(246255) protein phosphatase 2, regulatory subunit B, delta
sheep(101108180) protein phosphatase 2, regulatory subunit B, delta
domestic guinea pig(100731252) protein phosphatase 2, regulatory subunit B, delta
naked mole-rat(101709789) protein phosphatase 2, regulatory subunit B, delta
Zebrafish(327263) protein phosphatase 2, regulatory subunit B, delta isoform
chicken(423970) protein phosphatase 2, regulatory subunit B, delta
domestic cat(101086093) protein phosphatase 2, regulatory subunit B, delta
dog(491587) protein phosphatase 2, regulatory subunit B, delta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018461 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003656 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003656 Rosetta Predictions human pricing
NM_018461 Rosetta Predictions human pricing
NM_144746 Rosetta Predictions rat pricing
NM_026391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232866 predicted 1000
2 SASI_Hs01_00232868 predicted 1783
3 SASI_Hs01_00232869 predicted 1020
4 SASI_Hs01_00232870 predicted 1817
5 SASI_Hs01_00232872 predicted 1179
6 SASI_Hs01_00232874 predicted 1027
7 SASI_Hs02_00304299 predicted 1052
8 SASI_Hs02_00304300 predicted 1594
9 SASI_Hs02_00304301 predicted 1519
10 SASI_Hs02_00304302 predicted 1831
11 SASI_Hs01_00232865 predicted 1739
12 SASI_Hs01_00232867 predicted 1745
13 SASI_Hs01_00232871 predicted 1744
14 SASI_Hs01_00232873 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041128 predicted 1011
2 SASI_Hs01_00041130 predicted 1795
3 SASI_Hs01_00041131 predicted 1040
4 SASI_Hs01_00041132 predicted 1831
5 SASI_Hs01_00041134 predicted 1195
6 SASI_Hs01_00041136 predicted 1043
7 SASI_Hs02_00352017 predicted 1065
8 SASI_Hs02_00352018 predicted 1613
9 SASI_Hs02_00352019 predicted 1532
10 SASI_Hs02_00352020 predicted 1836
11 SASI_Hs01_00041127 predicted 1751
12 SASI_Hs01_00041129 predicted 1760
13 SASI_Hs01_00041133 predicted 1757
14 SASI_Hs01_00041135 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049826 predicted 656
2 SASI_Rn01_00049827 predicted 768
3 SASI_Rn01_00049828 predicted 1109
4 SASI_Rn01_00049829 predicted 1029
5 SASI_Rn01_00049830 predicted 974
6 SASI_Rn01_00049831 predicted 674
7 SASI_Rn01_00049832 predicted 1467
8 SASI_Rn01_00049833 predicted 255
9 SASI_Rn02_00268627 predicted 337
10 SASI_Rn01_00049834 predicted 1015
11 SASI_Rn01_00049835 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050244 predicted 673
2 SASI_Mm01_00050245 predicted 1046
3 SASI_Mm02_00330151 predicted 366
4 SASI_Mm02_00330152 predicted 1123
5 SASI_Mm01_00050247 predicted 967
6 SASI_Mm01_00050248 predicted 999
7 SASI_Mm02_00330153 predicted 1223
8 SASI_Mm01_00050250 predicted 353
9 SASI_Mm02_00330154 predicted 1024
10 SASI_Mm01_00050252 predicted 685
11 SASI_Mm01_00050243 predicted 971
12 SASI_Mm01_00050246 predicted 802
13 SASI_Mm01_00050249 predicted 984
14 SASI_Mm01_00050251 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026391
VALIDATED
PPP2R2D MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B, delta
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026391.2-735s21c1
Sequence:CCGGGAGAATTAACCTATGGCATTTCTCGAGAAATGCCATAGGTTAATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026391.2-662s21c1
Sequence:CCGGATGCTCATACATATCACATAACTCGAGTTATGTGATATGTATGAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026391.2-230s21c1
Sequence:CCGGTCATCTCCACCGTTGAGTTTACTCGAGTAAACTCAACGGTGGAGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026391.2-698s21c1
Sequence:CCGGATAGTGATCATGAAACATATCCTCGAGGATATGTTTCATGATCACTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026391.2-1444s1c1
Sequence:CCGGGCCACCAATAACTTGTATATACTCGAGTATATACAAGTTATTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026391.2-577s1c1
Sequence:CCGGCCATTTAGAATTACGGCACTACTCGAGTAGTGCCGTAATTCTAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026391.2-1194s1c1
Sequence:CCGGCGGTTCAGACAGTGCCATTATCTCGAGATAATGGCACTGTCTGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026391.2-846s1c1
Sequence:CCGGCCCACATCAGTGCAATGTATTCTCGAGAATACATTGCACTGATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026391
VALIDATED
PPP2R2D MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B, delta
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026391.2-735s21c1
Sequence:CCGGGAGAATTAACCTATGGCATTTCTCGAGAAATGCCATAGGTTAATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026391.2-662s21c1
Sequence:CCGGATGCTCATACATATCACATAACTCGAGTTATGTGATATGTATGAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026391.2-230s21c1
Sequence:CCGGTCATCTCCACCGTTGAGTTTACTCGAGTAAACTCAACGGTGGAGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026391.2-698s21c1
Sequence:CCGGATAGTGATCATGAAACATATCCTCGAGGATATGTTTCATGATCACTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026391.2-1444s1c1
Sequence:CCGGGCCACCAATAACTTGTATATACTCGAGTATATACAAGTTATTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026391.2-577s1c1
Sequence:CCGGCCATTTAGAATTACGGCACTACTCGAGTAGTGCCGTAATTCTAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026391.2-1194s1c1
Sequence:CCGGCGGTTCAGACAGTGCCATTATCTCGAGATAATGGCACTGTCTGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026391.2-846s1c1
Sequence:CCGGCCCACATCAGTGCAATGTATTCTCGAGAATACATTGCACTGATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026391
VALIDATED
PPP2R2D MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B, delta
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026391.2-735s21c1
Sequence:CCGGGAGAATTAACCTATGGCATTTCTCGAGAAATGCCATAGGTTAATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026391.2-662s21c1
Sequence:CCGGATGCTCATACATATCACATAACTCGAGTTATGTGATATGTATGAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026391.2-230s21c1
Sequence:CCGGTCATCTCCACCGTTGAGTTTACTCGAGTAAACTCAACGGTGGAGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026391.2-698s21c1
Sequence:CCGGATAGTGATCATGAAACATATCCTCGAGGATATGTTTCATGATCACTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026391.2-1444s1c1
Sequence:CCGGGCCACCAATAACTTGTATATACTCGAGTATATACAAGTTATTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026391.2-577s1c1
Sequence:CCGGCCATTTAGAATTACGGCACTACTCGAGTAGTGCCGTAATTCTAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026391.2-1194s1c1
Sequence:CCGGCGGTTCAGACAGTGCCATTATCTCGAGATAATGGCACTGTCTGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026391.2-846s1c1
Sequence:CCGGCCCACATCAGTGCAATGTATTCTCGAGAATACATTGCACTGATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018461
PPP2R2D MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B, delta
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-745s21c1
Sequence:CCGGGCAGATGACCTGAGAATTAATCTCGAGATTAATTCTCAGGTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-996s21c1
Sequence:CCGGGTCCTTCTTCTCAGAAATAATCTCGAGATTATTTCTGAGAAGAAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-683s21c1
Sequence:CCGGATGCTCACACATATCATATAACTCGAGTTATATGATATGTGTGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018461.2-1853s21c1
Sequence:CCGGACCGCTCTTTCTCCAACTTTCCTCGAGGAAAGTTGGAGAAAGAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-236s21c1
Sequence:CCGGTGGCCGAAGCGGACATCATTTCTCGAGAAATGATGTCCGCTTCGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-562s21c1
Sequence:GTACCGGTATAACCTGAAAGACGAAGATCTCGAGATCTTCGTCTTTCAGGTTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-1206s21c1
Sequence:GTACCGGTTGCTGGAACGGTTCGGATAGCTCGAGCTATCCGAACCGTTCCAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-781s21c1
Sequence:GTACCGGATCACAGATAGAAGCTTTAACCTCGAGGTTAAAGCTTCTATCTGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018461.2-1462s1c1
Sequence:CCGGGCTGCCACCAATAACTTGTACCTCGAGGTACAAGTTATTGGTGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018461.2-386s1c1
Sequence:CCGGGCACCTTTCAAAGTCATGAACCTCGAGGTTCATGACTTTGAAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018461.2-390s1c1
Sequence:CCGGCTTTCAAAGTCATGAACCGGACTCGAGTCCGGTTCATGACTTTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018461
PPP2R2D MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B, delta
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-745s21c1
Sequence:CCGGGCAGATGACCTGAGAATTAATCTCGAGATTAATTCTCAGGTCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-996s21c1
Sequence:CCGGGTCCTTCTTCTCAGAAATAATCTCGAGATTATTTCTGAGAAGAAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-683s21c1
Sequence:CCGGATGCTCACACATATCATATAACTCGAGTTATATGATATGTGTGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018461.2-1853s21c1
Sequence:CCGGACCGCTCTTTCTCCAACTTTCCTCGAGGAAAGTTGGAGAAAGAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-236s21c1
Sequence:CCGGTGGCCGAAGCGGACATCATTTCTCGAGAAATGATGTCCGCTTCGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-562s21c1
Sequence:GTACCGGTATAACCTGAAAGACGAAGATCTCGAGATCTTCGTCTTTCAGGTTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-1206s21c1
Sequence:GTACCGGTTGCTGGAACGGTTCGGATAGCTCGAGCTATCCGAACCGTTCCAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-781s21c1
Sequence:GTACCGGATCACAGATAGAAGCTTTAACCTCGAGGTTAAAGCTTCTATCTGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018461.2-1462s1c1
Sequence:CCGGGCTGCCACCAATAACTTGTACCTCGAGGTACAAGTTATTGGTGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018461.2-386s1c1
Sequence:CCGGGCACCTTTCAAAGTCATGAACCTCGAGGTTCATGACTTTGAAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018461.2-390s1c1
Sequence:CCGGCTTTCAAAGTCATGAACCGGACTCGAGTCCGGTTCATGACTTTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018461
PPP2R2D MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B, delta
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-745s21c1
Sequence:CCGGGCAGATGACCTGAGAATTAATCTCGAGATTAATTCTCAGGTCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-996s21c1
Sequence:CCGGGTCCTTCTTCTCAGAAATAATCTCGAGATTATTTCTGAGAAGAAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-683s21c1
Sequence:CCGGATGCTCACACATATCATATAACTCGAGTTATATGATATGTGTGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018461.2-1853s21c1
Sequence:CCGGACCGCTCTTTCTCCAACTTTCCTCGAGGAAAGTTGGAGAAAGAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-236s21c1
Sequence:CCGGTGGCCGAAGCGGACATCATTTCTCGAGAAATGATGTCCGCTTCGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-562s21c1
Sequence:GTACCGGTATAACCTGAAAGACGAAGATCTCGAGATCTTCGTCTTTCAGGTTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-1206s21c1
Sequence:GTACCGGTTGCTGGAACGGTTCGGATAGCTCGAGCTATCCGAACCGTTCCAGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018461.2-781s21c1
Sequence:GTACCGGATCACAGATAGAAGCTTTAACCTCGAGGTTAAAGCTTCTATCTGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018461.2-1462s1c1
Sequence:CCGGGCTGCCACCAATAACTTGTACCTCGAGGTACAAGTTATTGGTGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018461.2-386s1c1
Sequence:CCGGGCACCTTTCAAAGTCATGAACCTCGAGGTTCATGACTTTGAAAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018461.2-390s1c1
Sequence:CCGGCTTTCAAAGTCATGAACCGGACTCGAGTCCGGTTCATGACTTTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003656
VALIDATED
PPP2R2D MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B, delta
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-1144s1c1
Sequence:CCGGGCTCTGCTCTCTCTATGAGAACTCGAGTTCTCATAGAGAGAGCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-1451s1c1
Sequence:CCGGGCCACCAATAACTTGTACATACTCGAGTATGTACAAGTTATTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-1225s1c1
Sequence:CCGGCGGGTCCTATAACAACTTCTTCTCGAGAAGAAGTTGTTATAGGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-982s1c1
Sequence:CCGGGTCCTTCTTCTCAGAAATAATCTCGAGATTATTTCTGAGAAGAAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-1524s1c1
Sequence:CCGGGCATAGTTAAGCCGGACATTTCTCGAGAAATGTCCGGCTTAACTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003656
VALIDATED
PPP2R2D MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B, delta
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-1144s1c1
Sequence:CCGGGCTCTGCTCTCTCTATGAGAACTCGAGTTCTCATAGAGAGAGCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-1451s1c1
Sequence:CCGGGCCACCAATAACTTGTACATACTCGAGTATGTACAAGTTATTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-1225s1c1
Sequence:CCGGCGGGTCCTATAACAACTTCTTCTCGAGAAGAAGTTGTTATAGGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-982s1c1
Sequence:CCGGGTCCTTCTTCTCAGAAATAATCTCGAGATTATTTCTGAGAAGAAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-1524s1c1
Sequence:CCGGGCATAGTTAAGCCGGACATTTCTCGAGAAATGTCCGGCTTAACTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003656
VALIDATED
PPP2R2D MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B, delta
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-1144s1c1
Sequence:CCGGGCTCTGCTCTCTCTATGAGAACTCGAGTTCTCATAGAGAGAGCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-1451s1c1
Sequence:CCGGGCCACCAATAACTTGTACATACTCGAGTATGTACAAGTTATTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-1225s1c1
Sequence:CCGGCGGGTCCTATAACAACTTCTTCTCGAGAAGAAGTTGTTATAGGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-982s1c1
Sequence:CCGGGTCCTTCTTCTCAGAAATAATCTCGAGATTATTTCTGAGAAGAAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001003656.1-1524s1c1
Sequence:CCGGGCATAGTTAAGCCGGACATTTCTCGAGAAATGTCCGGCTTAACTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)