EMAIL THIS PAGE TO A FRIEND

PPP2R3A

protein phosphatase 2, regulatory subunit B'', alpha

246 Gene Product Result for
Synonyms: PPP2R3 PR130 PR72
UniProtKB ID: Q06190, A8KAE7, B4DNU1, B7ZAE3, Q06189, Q9NPQ5
Gene ID:
Human(5523) Summary: This gene encodes one of the regulatory subunits of the protein phosphatase 2. Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the alpha subfamily of regulatory subunit B''. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Jun 2010]
Mouse(235542) protein phosphatase 2, regulatory subunit B'', alpha
Rat(363122) protein phosphatase 2, regulatory subunit B'', alpha
chicken(424733) protein phosphatase 2, regulatory subunit B'', alpha
Horse(100053302) protein phosphatase 2, regulatory subunit B'', alpha
dog(485672) protein phosphatase 2, regulatory subunit B'', alpha
domestic cat(101083363) protein phosphatase 2, regulatory subunit B'', alpha
naked mole-rat(101697272) protein phosphatase 2, regulatory subunit B'', alpha
Domestic Rabbit(100353545) protein phosphatase 2, regulatory subunit B'', alpha
domestic guinea pig(100729010) protein phosphatase 2, regulatory subunit B'', alpha
cow(100851082) protein phosphatase 2, regulatory subunit B'', alpha
sheep(101114233) protein phosphatase 2, regulatory subunit B'', alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C7632 Cantharidin human pricing
D6908 DL-erythro-Dihydrosphingosine ≥99%, synthetic human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_135153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_135153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_135153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002718 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091911 MISSION® esiRNA esiRNA human PPP2R3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002718 Rosetta Predictions human pricing
NM_181897 Rosetta Predictions human pricing
NM_001012202 Rosetta Predictions rat pricing
XM_001059170 Rosetta Predictions rat pricing
XM_001067204 Rosetta Predictions rat pricing
XM_001067256 Rosetta Predictions rat pricing
XM_576459 Rosetta Predictions rat pricing
XM_001004716 Rosetta Predictions mouse pricing
XM_001004721 Rosetta Predictions mouse pricing
XM_001474396 Rosetta Predictions mouse pricing
XM_001475836 Rosetta Predictions mouse pricing
XM_135153 Rosetta Predictions mouse pricing
XM_897869 Rosetta Predictions mouse pricing
XM_897879 Rosetta Predictions mouse pricing
XM_897889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122838 predicted 3073
2 SASI_Hs01_00122840 predicted 3710
3 SASI_Hs01_00122841 predicted 3591
4 SASI_Hs01_00122842 predicted 2926
5 SASI_Hs01_00122843 predicted 4010
6 SASI_Hs02_00334310 predicted 2990
7 SASI_Hs01_00122844 predicted 3059
8 SASI_Hs01_00122845 predicted 2933
9 SASI_Hs01_00122846 predicted 2953
10 SASI_Hs02_00334311 predicted 4103
11 SASI_Hs01_00122839 predicted 3268
12 SASI_Hs01_00122847 predicted 3218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183330 predicted 976
2 SASI_Hs01_00183332 predicted 1614
3 SASI_Hs01_00183333 predicted 1492
4 SASI_Hs01_00183334 predicted 829
5 SASI_Hs01_00183335 predicted 1905
6 SASI_Hs02_00370473 predicted 898
7 SASI_Hs01_00183336 predicted 960
8 SASI_Hs01_00183337 predicted 834
9 SASI_Hs01_00183338 predicted 858
10 SASI_Hs02_00370474 predicted 2007
11 SASI_Hs01_00183331 predicted 1172
12 SASI_Hs01_00183339 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200431 predicted 1407
2 SASI_Rn02_00200432 predicted 3398
3 SASI_Rn02_00200433 predicted 1901
4 SASI_Rn02_00200434 predicted 742
5 SASI_Rn02_00200435 predicted 1231
6 SASI_Rn02_00200436 predicted 1988
7 SASI_Rn02_00200437 predicted 1214
8 SASI_Rn02_00200438 predicted 1197
9 SASI_Rn02_00200439 predicted 574
10 SASI_Rn02_00200440 predicted 2861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292228 predicted 1127
2 SASI_Rn02_00292229 predicted 1527
3 SASI_Rn02_00292230 predicted 1512
4 SASI_Rn02_00292231 predicted 928
5 SASI_Rn02_00292232 predicted 1280
6 SASI_Rn02_00292233 predicted 1885
7 SASI_Rn02_00292234 predicted 1866
8 SASI_Rn02_00292235 predicted 996
9 SASI_Rn02_00292236 predicted 1110
10 SASI_Rn02_00292237 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320221 predicted 1412
2 SASI_Rn02_00320222 predicted 3397
3 SASI_Rn02_00320223 predicted 1903
4 SASI_Rn02_00320224 predicted 743
5 SASI_Rn02_00320225 predicted 1236
6 SASI_Rn02_00320226 predicted 1992
7 SASI_Rn02_00320227 predicted 1210
8 SASI_Rn02_00320228 predicted 1193
9 SASI_Rn02_00320229 predicted 575
10 SASI_Rn02_00320230 predicted 2860
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320406 predicted 1118
2 SASI_Rn02_00320407 predicted 1527
3 SASI_Rn02_00320408 predicted 1518
4 SASI_Rn02_00320409 predicted 929
5 SASI_Rn02_00320410 predicted 1283
6 SASI_Rn02_00320411 predicted 1880
7 SASI_Rn02_00320412 predicted 1866
8 SASI_Rn02_00320413 predicted 995
9 SASI_Rn02_00320414 predicted 1104
10 SASI_Rn02_00320415 predicted 1798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405393 predicted 2990
2 SASI_Rn02_00405394 predicted 3397
3 SASI_Rn02_00405395 predicted 3388
4 SASI_Rn02_00405396 predicted 2800
5 SASI_Rn02_00405397 predicted 3159
6 SASI_Rn02_00405398 predicted 3748
7 SASI_Rn02_00405399 predicted 3734
8 SASI_Rn02_00405400 predicted 2860
9 SASI_Rn02_00405401 predicted 2979
10 SASI_Rn02_00405402 predicted 3672
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232641 predicted 2258
2 SASI_Mm01_00232642 predicted 2029
3 SASI_Mm01_00232643 predicted 673
4 SASI_Mm01_00232644 predicted 2043
5 SASI_Mm01_00232645 predicted 1521
6 SASI_Mm01_00232646 predicted 1228
7 SASI_Mm01_00232647 predicted 1448
8 SASI_Mm01_00232648 predicted 1506
9 SASI_Mm01_00232649 predicted 1043
10 SASI_Mm01_00232650 predicted 2213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249648 predicted 2034
2 SASI_Mm01_00249649 predicted 2590
3 SASI_Mm01_00249650 predicted 671
4 SASI_Mm01_00249651 predicted 2045
5 SASI_Mm01_00249652 predicted 1527
6 SASI_Mm01_00249653 predicted 1234
7 SASI_Mm01_00249654 predicted 1448
8 SASI_Mm01_00249655 predicted 1502
9 SASI_Mm01_00249656 predicted 1043
10 SASI_Mm01_00249657 predicted 2218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00375070 predicted 1990
2 SASI_Mm02_00375071 predicted 4053
3 SASI_Mm02_00375072 predicted 1479
4 SASI_Mm02_00375073 predicted 3596
5 SASI_Mm02_00375074 predicted 1192
6 SASI_Mm02_00375075 predicted 1410
7 SASI_Mm02_00375076 predicted 1467
8 SASI_Mm02_00375077 predicted 998
9 SASI_Mm02_00375078 predicted 2177
10 SASI_Mm02_00375079 predicted 3328
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00385262 predicted 1984
2 SASI_Mm02_00385263 predicted 1484
3 SASI_Mm02_00385264 predicted 1186
4 SASI_Mm02_00385265 predicted 1411
5 SASI_Mm02_00385266 predicted 1466
6 SASI_Mm02_00385267 predicted 1005
7 SASI_Mm02_00385268 predicted 2178
8 SASI_Mm02_00385269 predicted 3324
9 SASI_Mm02_00385270 predicted 677
10 SASI_Mm02_00385271 predicted 3137
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236453 predicted 4476
2 SASI_Mm01_00236454 predicted 4505
3 SASI_Mm01_00236455 predicted 4512
4 SASI_Mm01_00236456 predicted 4522
5 SASI_Mm01_00236457 predicted 4521
6 SASI_Mm01_00236458 predicted 4469
7 SASI_Mm01_00236459 predicted 4466
8 SASI_Mm01_00236460 predicted 4468
9 SASI_Mm01_00236461 predicted 4470
10 SASI_Mm01_00236462 predicted 4508
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258380 predicted 369
2 SASI_Mm01_00258381 predicted 934
3 SASI_Mm01_00258382 predicted 944
4 SASI_Mm01_00258383 predicted 688
5 SASI_Mm01_00258384 predicted 531
6 SASI_Mm01_00258385 predicted 913
7 SASI_Mm01_00258386 predicted 664
8 SASI_Mm01_00258387 predicted 643
9 SASI_Mm01_00258388 predicted 519
10 SASI_Mm01_00258389 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262433 predicted 2310
2 SASI_Mm01_00262434 predicted 2347
3 SASI_Mm01_00262435 predicted 2348
4 SASI_Mm01_00262436 predicted 2362
5 SASI_Mm01_00262437 predicted 2356
6 SASI_Mm01_00262438 predicted 2316
7 SASI_Mm01_00262439 predicted 2315
8 SASI_Mm01_00262440 predicted 2310
9 SASI_Mm01_00262441 predicted 2316
10 SASI_Mm01_00262442 predicted 2352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229987 predicted 379
2 SASI_Mm01_00229988 predicted 1112
3 SASI_Mm01_00229989 predicted 743
4 SASI_Mm01_00229990 predicted 1381
5 SASI_Mm01_00229991 predicted 1446
6 SASI_Mm01_00229992 predicted 914
7 SASI_Mm01_00229993 predicted 933
8 SASI_Mm01_00229994 predicted 638
9 SASI_Mm01_00229995 predicted 1177
10 SASI_Mm01_00229996 predicted 986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_135153
VALIDATED
PPP2R3A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B'', alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135153.5-3979s1c1
Sequence:CCGGCCTTGAACTTACCTGGTTTAACTCGAGTTAAACCAGGTAAGTTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135153.5-3372s1c1
Sequence:CCGGGCTCATTTGAAGACTATGAATCTCGAGATTCATAGTCTTCAAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135153.5-2583s1c1
Sequence:CCGGCCACGGTTGTTCAGAGAATATCTCGAGATATTCTCTGAACAACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135153.5-1226s1c1
Sequence:CCGGCCGTTATTAACCATAAACCATCTCGAGATGGTTTATGGTTAATAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135153.5-126s1c1
Sequence:CCGGCCATACATTATTGCACTGGAACTCGAGTTCCAGTGCAATAATGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_135153
VALIDATED
PPP2R3A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B'', alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135153.5-3979s1c1
Sequence:CCGGCCTTGAACTTACCTGGTTTAACTCGAGTTAAACCAGGTAAGTTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135153.5-3372s1c1
Sequence:CCGGGCTCATTTGAAGACTATGAATCTCGAGATTCATAGTCTTCAAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135153.5-2583s1c1
Sequence:CCGGCCACGGTTGTTCAGAGAATATCTCGAGATATTCTCTGAACAACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135153.5-1226s1c1
Sequence:CCGGCCGTTATTAACCATAAACCATCTCGAGATGGTTTATGGTTAATAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135153.5-126s1c1
Sequence:CCGGCCATACATTATTGCACTGGAACTCGAGTTCCAGTGCAATAATGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_135153
VALIDATED
PPP2R3A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B'', alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135153.5-3979s1c1
Sequence:CCGGCCTTGAACTTACCTGGTTTAACTCGAGTTAAACCAGGTAAGTTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135153.5-3372s1c1
Sequence:CCGGGCTCATTTGAAGACTATGAATCTCGAGATTCATAGTCTTCAAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_135153.5-2583s1c1
Sequence:CCGGCCACGGTTGTTCAGAGAATATCTCGAGATATTCTCTGAACAACCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135153.5-1226s1c1
Sequence:CCGGCCGTTATTAACCATAAACCATCTCGAGATGGTTTATGGTTAATAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135153.5-126s1c1
Sequence:CCGGCCATACATTATTGCACTGGAACTCGAGTTCCAGTGCAATAATGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002718
PPP2R3A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B'', alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002718.3-4391s1c1
Sequence:CCGGGCCTAGAAGAAACCTTCACTTCTCGAGAAGTGAAGGTTTCTTCTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002718.3-2957s1c1
Sequence:CCGGGCCTCTAAATTCATCTGTCTTCTCGAGAAGACAGATGAATTTAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002718.3-3105s1c1
Sequence:CCGGCCACGGTTATTCAGAGAATATCTCGAGATATTCTCTGAATAACCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002718.3-3363s1c1
Sequence:CCGGGCAGGATTATTGAAAGGATATCTCGAGATATCCTTTCAATAATCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002718.3-670s1c1
Sequence:CCGGCCACACCTTCACACATGGAATCTCGAGATTCCATGTGTGAAGGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002718.3-4470s21c1
Sequence:CCGGTTGACTTAGCCCTAGTAATAACTCGAGTTATTACTAGGGCTAAGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002718.3-2218s21c1
Sequence:CCGGTGTAGATCTTGAGCCTAAATCCTCGAGGATTTAGGCTCAAGATCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002718.3-3327s21c1
Sequence:CCGGCCGATCTGTCTCGATACAATGCTCGAGCATTGTATCGAGACAGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002718
PPP2R3A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B'', alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002718.3-4391s1c1
Sequence:CCGGGCCTAGAAGAAACCTTCACTTCTCGAGAAGTGAAGGTTTCTTCTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002718.3-2957s1c1
Sequence:CCGGGCCTCTAAATTCATCTGTCTTCTCGAGAAGACAGATGAATTTAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002718.3-3105s1c1
Sequence:CCGGCCACGGTTATTCAGAGAATATCTCGAGATATTCTCTGAATAACCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002718.3-3363s1c1
Sequence:CCGGGCAGGATTATTGAAAGGATATCTCGAGATATCCTTTCAATAATCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002718.3-670s1c1
Sequence:CCGGCCACACCTTCACACATGGAATCTCGAGATTCCATGTGTGAAGGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002718.3-4470s21c1
Sequence:CCGGTTGACTTAGCCCTAGTAATAACTCGAGTTATTACTAGGGCTAAGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002718.3-2218s21c1
Sequence:CCGGTGTAGATCTTGAGCCTAAATCCTCGAGGATTTAGGCTCAAGATCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002718.3-3327s21c1
Sequence:CCGGCCGATCTGTCTCGATACAATGCTCGAGCATTGTATCGAGACAGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002718
PPP2R3A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B'', alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002718.3-4391s1c1
Sequence:CCGGGCCTAGAAGAAACCTTCACTTCTCGAGAAGTGAAGGTTTCTTCTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002718.3-2957s1c1
Sequence:CCGGGCCTCTAAATTCATCTGTCTTCTCGAGAAGACAGATGAATTTAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002718.3-3105s1c1
Sequence:CCGGCCACGGTTATTCAGAGAATATCTCGAGATATTCTCTGAATAACCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002718.3-3363s1c1
Sequence:CCGGGCAGGATTATTGAAAGGATATCTCGAGATATCCTTTCAATAATCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002718.3-670s1c1
Sequence:CCGGCCACACCTTCACACATGGAATCTCGAGATTCCATGTGTGAAGGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002718.3-4470s21c1
Sequence:CCGGTTGACTTAGCCCTAGTAATAACTCGAGTTATTACTAGGGCTAAGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002718.3-2218s21c1
Sequence:CCGGTGTAGATCTTGAGCCTAAATCCTCGAGGATTTAGGCTCAAGATCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002718.3-3327s21c1
Sequence:CCGGCCGATCTGTCTCGATACAATGCTCGAGCATTGTATCGAGACAGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)