EMAIL THIS PAGE TO A FRIEND

PPP2R3B

protein phosphatase 2, regulatory subunit B'', beta

56 Gene Product Result for
Synonyms: NYREN8 PPP2R3L PPP2R3LY PR48
UniProtKB ID: Q9Y5P8, Q6P4G9, Q7RTT1, Q96H01
Gene ID:
Human(28227) Summary: Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the beta subfamily of regulatory subunit B''. [provided by RefSeq, Apr 2010]
Rat(682033) protein phosphatase 2, regulatory subunit B'', beta
cow(100298789) protein phosphatase 2, regulatory subunit B'', beta
sheep(101116812) protein phosphatase 2, regulatory subunit B'', beta
naked mole-rat(101726501) protein phosphatase 2, regulatory subunit B'', beta
Zebrafish(566032) protein phosphatase 2, regulatory subunit B'', beta
Horse(100060079) protein phosphatase 2, regulatory subunit B'', beta
dog(607103) protein phosphatase 2, regulatory subunit B'', beta
chicken(418670) protein phosphatase 2, regulatory subunit B'', beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407361 Anti-PPP2R3B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1409133 Anti-PPP2R3B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV42371 Anti-PPP2R3B antibody produced in rabbit affinity isolated antibody canine, human
western blot pricing
SAB2101862 Anti-PPP2R3B antibody produced in rabbit affinity isolated antibody mouse, rabbit, horse, zebrafish, canine, rat, human, guinea pig
western blot pricing
SAB4501229 Anti-PPP2R3B antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB1410560 Anti-PPP2R3B antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1410561 Anti-PPP2R3B antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1306045 ANTI-PR48(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1409132 Monoclonal Anti-PPP2R3B antibody produced in mouse clone 1F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1403205 Monoclonal Anti-PPP2R3B, (N-terminal) antibody produced in mouse clone 2E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013239 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074491 MISSION® esiRNA esiRNA human PPP2R3B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013239 Rosetta Predictions human pricing
NM_199326 Rosetta Predictions human pricing
XM_001059486 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230959 predicted 1573
2 SASI_Hs01_00230961 predicted 1590
3 SASI_Hs01_00230962 predicted 1527
4 SASI_Hs01_00230963 predicted 1578
5 SASI_Hs01_00230964 predicted 1581
6 SASI_Hs01_00230965 predicted 1641
7 SASI_Hs01_00230966 predicted 1622
8 SASI_Hs01_00230967 predicted 1591
9 SASI_Hs01_00230968 predicted 1544
10 SASI_Hs02_00344435 predicted 1686
11 SASI_Hs01_00230960 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238165 predicted 749
2 SASI_Hs01_00238167 predicted 761
3 SASI_Hs01_00238168 predicted 696
4 SASI_Hs01_00238169 predicted 754
5 SASI_Hs01_00238170 predicted 753
6 SASI_Hs01_00238171 predicted 821
7 SASI_Hs01_00238172 predicted 790
8 SASI_Hs01_00238173 predicted 763
9 SASI_Hs01_00238174 predicted 721
10 SASI_Hs02_00372741 predicted 863
11 SASI_Hs01_00238166 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059486 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293379 predicted 3461
2 SASI_Rn02_00293380 predicted 3341
3 SASI_Rn02_00293381 predicted 2691
4 SASI_Rn02_00293382 predicted 2875
5 SASI_Rn02_00293383 predicted 3345
6 SASI_Rn02_00293384 predicted 3097
7 SASI_Rn02_00293385 predicted 3558
8 SASI_Rn02_00293386 predicted 2676
9 SASI_Rn02_00293387 predicted 2876
10 SASI_Rn02_00293388 predicted 2875
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013239
PPP2R3B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B'', beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013239.3-1313s21c1
Sequence:CCGGAGATCAGCTATGCCGACTTTGCTCGAGCAAAGTCGGCATAGCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013239.3-1128s21c1
Sequence:CCGGATTCTTCTCGTACGAGCATTTCTCGAGAAATGCTCGTACGAGAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013239.3-1233s21c1
Sequence:CCGGCCACGCCCTTTCTACCAAGATCTCGAGATCTTGGTAGAAAGGGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013239.3-1583s21c1
Sequence:CCGGGCAAGCTGGCTAACGTCTTCTCTCGAGAGAAGACGTTAGCCAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-1140s1c1
Sequence:CCGGCGAGCATTTCTACGTCATCTACTCGAGTAGATGACGTAGAAATGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-1236s1c1
Sequence:CCGGCGCCCTTTCTACCAAGATGATCTCGAGATCATCTTGGTAGAAAGGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-1002s1c1
Sequence:CCGGGCGGATCTTCTACGCCGTGAACTCGAGTTCACGGCGTAGAAGATCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-786s1c1
Sequence:CCGGCGTCCACAAGTTCGTCGCCATCTCGAGATGGCGACGAACTTGTGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-567s1c1
Sequence:CCGGCCAAAGCATTCCGACCTTCTACTCGAGTAGAAGGTCGGAATGCTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013239
PPP2R3B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B'', beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013239.3-1313s21c1
Sequence:CCGGAGATCAGCTATGCCGACTTTGCTCGAGCAAAGTCGGCATAGCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013239.3-1128s21c1
Sequence:CCGGATTCTTCTCGTACGAGCATTTCTCGAGAAATGCTCGTACGAGAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013239.3-1233s21c1
Sequence:CCGGCCACGCCCTTTCTACCAAGATCTCGAGATCTTGGTAGAAAGGGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013239.3-1583s21c1
Sequence:CCGGGCAAGCTGGCTAACGTCTTCTCTCGAGAGAAGACGTTAGCCAGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-1140s1c1
Sequence:CCGGCGAGCATTTCTACGTCATCTACTCGAGTAGATGACGTAGAAATGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-1236s1c1
Sequence:CCGGCGCCCTTTCTACCAAGATGATCTCGAGATCATCTTGGTAGAAAGGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-1002s1c1
Sequence:CCGGGCGGATCTTCTACGCCGTGAACTCGAGTTCACGGCGTAGAAGATCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-786s1c1
Sequence:CCGGCGTCCACAAGTTCGTCGCCATCTCGAGATGGCGACGAACTTGTGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-567s1c1
Sequence:CCGGCCAAAGCATTCCGACCTTCTACTCGAGTAGAAGGTCGGAATGCTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013239
PPP2R3B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B'', beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013239.3-1313s21c1
Sequence:CCGGAGATCAGCTATGCCGACTTTGCTCGAGCAAAGTCGGCATAGCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013239.3-1128s21c1
Sequence:CCGGATTCTTCTCGTACGAGCATTTCTCGAGAAATGCTCGTACGAGAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013239.3-1233s21c1
Sequence:CCGGCCACGCCCTTTCTACCAAGATCTCGAGATCTTGGTAGAAAGGGCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013239.3-1583s21c1
Sequence:CCGGGCAAGCTGGCTAACGTCTTCTCTCGAGAGAAGACGTTAGCCAGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-1140s1c1
Sequence:CCGGCGAGCATTTCTACGTCATCTACTCGAGTAGATGACGTAGAAATGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-1236s1c1
Sequence:CCGGCGCCCTTTCTACCAAGATGATCTCGAGATCATCTTGGTAGAAAGGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-1002s1c1
Sequence:CCGGGCGGATCTTCTACGCCGTGAACTCGAGTTCACGGCGTAGAAGATCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-786s1c1
Sequence:CCGGCGTCCACAAGTTCGTCGCCATCTCGAGATGGCGACGAACTTGTGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013239.3-567s1c1
Sequence:CCGGCCAAAGCATTCCGACCTTCTACTCGAGTAGAAGGTCGGAATGCTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)