EMAIL THIS PAGE TO A FRIEND

PPP2R3C

protein phosphatase 2, regulatory subunit B'', gamma

45 Gene Product Result for
Synonyms: C14orf10 G4-1 G5pr
Gene ID:
Mouse(59032) protein phosphatase 2, regulatory subunit B'', gamma
Rat(362739) protein phosphatase 2, regulatory subunit B'', gamma
Zebrafish(393100) protein phosphatase 2, regulatory subunit B'', gamma
chicken(423324) protein phosphatase 2, regulatory subunit B', gamma
dog(480289) protein phosphatase 2, regulatory subunit B'', gamma
domestic cat(101084114) protein phosphatase 2, regulatory subunit B'', gamma
naked mole-rat(101709952) protein phosphatase 2, regulatory subunit B'', gamma
Domestic Rabbit(100356580) protein phosphatase 2, regulatory subunit B'', gamma
domestic guinea pig(100720531) protein phosphatase 2, regulatory subunit B'', gamma
cow(533147) protein phosphatase 2, regulatory subunit B'', gamma
sheep(101119424) protein phosphatase 2, regulatory subunit B'', gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017917 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017917 Rosetta Predictions human pricing
NM_001014196 Rosetta Predictions rat pricing
NM_021529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209296 predicted 874
2 SASI_Hs02_00350905 predicted 833
3 SASI_Hs01_00209297 predicted 1266
4 SASI_Hs01_00209298 predicted 1218
5 SASI_Hs01_00209299 predicted 1605
6 SASI_Hs01_00209300 predicted 967
7 SASI_Hs01_00209301 predicted 1256
8 SASI_Hs01_00209302 predicted 1311
9 SASI_Hs01_00209303 predicted 1317
10 SASI_Hs01_00209304 predicted 788
11 SASI_Hs01_00209305 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201715 predicted 1393
2 SASI_Rn01_00109254 predicted 688
3 SASI_Rn01_00109255 predicted 554
4 SASI_Rn01_00109256 predicted 600
5 SASI_Rn01_00109257 predicted 1157
6 SASI_Rn01_00109258 predicted 392
7 SASI_Rn01_00109259 predicted 1023
8 SASI_Rn02_00201716 predicted 285
9 SASI_Rn01_00109260 predicted 835
10 SASI_Rn01_00109261 predicted 814
11 SASI_Rn01_00109262 predicted 1004
12 SASI_Rn01_00109263 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149703 predicted 690
2 SASI_Mm02_00326263 predicted 615
3 SASI_Mm01_00149704 predicted 742
4 SASI_Mm02_00326264 predicted 658
5 SASI_Mm01_00149705 predicted 448
6 SASI_Mm01_00149707 predicted 1091
7 SASI_Mm01_00149708 predicted 1013
8 SASI_Mm01_00149709 predicted 683
9 SASI_Mm01_00149710 predicted 1194
10 SASI_Mm01_00149711 predicted 1286
11 SASI_Mm01_00149706 predicted 1584
12 SASI_Mm01_00149712 predicted 1157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017917
VALIDATED
PPP2R3C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B'', gamma
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017917.2-474s21c1
Sequence:CCGGCGAATGGAAAGGAGGTAGAAACTCGAGTTTCTACCTCCTTTCCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017917.2-967s1c1
Sequence:CCGGCCACAATTAGATGGTCTGGAACTCGAGTTCCAGACCATCTAATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017917.2-1528s1c1
Sequence:CCGGGATGAAATCTTTGACATGGTACTCGAGTACCATGTCAAAGATTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017917.2-679s1c1
Sequence:CCGGCCACCTATGATTGGAGAGGAACTCGAGTTCCTCTCCAATCATAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017917.2-474s1c1
Sequence:CCGGCGAATGGAAAGGAGGTAGAAACTCGAGTTTCTACCTCCTTTCCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017917.2-1091s1c1
Sequence:CCGGGCAGCTTCCTAGATGATTTATCTCGAGATAAATCATCTAGGAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017917.2-967s21c1
Sequence:CCGGCCACAATTAGATGGTCTGGAACTCGAGTTCCAGACCATCTAATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017917.2-1091s21c1
Sequence:CCGGGCAGCTTCCTAGATGATTTATCTCGAGATAAATCATCTAGGAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017917.2-679s21c1
Sequence:CCGGCCACCTATGATTGGAGAGGAACTCGAGTTCCTCTCCAATCATAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017917
VALIDATED
PPP2R3C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B'', gamma
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017917.2-474s21c1
Sequence:CCGGCGAATGGAAAGGAGGTAGAAACTCGAGTTTCTACCTCCTTTCCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017917.2-967s1c1
Sequence:CCGGCCACAATTAGATGGTCTGGAACTCGAGTTCCAGACCATCTAATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017917.2-1528s1c1
Sequence:CCGGGATGAAATCTTTGACATGGTACTCGAGTACCATGTCAAAGATTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017917.2-679s1c1
Sequence:CCGGCCACCTATGATTGGAGAGGAACTCGAGTTCCTCTCCAATCATAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017917.2-474s1c1
Sequence:CCGGCGAATGGAAAGGAGGTAGAAACTCGAGTTTCTACCTCCTTTCCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017917.2-1091s1c1
Sequence:CCGGGCAGCTTCCTAGATGATTTATCTCGAGATAAATCATCTAGGAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017917.2-967s21c1
Sequence:CCGGCCACAATTAGATGGTCTGGAACTCGAGTTCCAGACCATCTAATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017917.2-1091s21c1
Sequence:CCGGGCAGCTTCCTAGATGATTTATCTCGAGATAAATCATCTAGGAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017917.2-679s21c1
Sequence:CCGGCCACCTATGATTGGAGAGGAACTCGAGTTCCTCTCCAATCATAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017917
VALIDATED
PPP2R3C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B'', gamma
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017917.2-474s21c1
Sequence:CCGGCGAATGGAAAGGAGGTAGAAACTCGAGTTTCTACCTCCTTTCCATTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000055853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017917.2-967s1c1
Sequence:CCGGCCACAATTAGATGGTCTGGAACTCGAGTTCCAGACCATCTAATTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000055857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017917.2-1528s1c1
Sequence:CCGGGATGAAATCTTTGACATGGTACTCGAGTACCATGTCAAAGATTTCATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000055854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017917.2-679s1c1
Sequence:CCGGCCACCTATGATTGGAGAGGAACTCGAGTTCCTCTCCAATCATAGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000055856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017917.2-474s1c1
Sequence:CCGGCGAATGGAAAGGAGGTAGAAACTCGAGTTTCTACCTCCTTTCCATTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000055855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017917.2-1091s1c1
Sequence:CCGGGCAGCTTCCTAGATGATTTATCTCGAGATAAATCATCTAGGAAGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017917.2-967s21c1
Sequence:CCGGCCACAATTAGATGGTCTGGAACTCGAGTTCCAGACCATCTAATTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017917.2-1091s21c1
Sequence:CCGGGCAGCTTCCTAGATGATTTATCTCGAGATAAATCATCTAGGAAGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017917.2-679s21c1
Sequence:CCGGCCACCTATGATTGGAGAGGAACTCGAGTTCCTCTCCAATCATAGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021529
VALIDATED
PPP2R3C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B'', gamma
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021529.2-2000s1c1
Sequence:CCGGGCCTTTAACCTTGAACTCTTACTCGAGTAAGAGTTCAAGGTTAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021529.3-509s1c1
Sequence:CCGGCGAAGAGTTGCAGAACTTATGCTCGAGCATAAGTTCTGCAACTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021529.2-301s1c1
Sequence:CCGGCAAATACTACTCAGAGTGGAACTCGAGTTCCACTCTGAGTAGTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-1488s21c1
Sequence:CCGGGTCACTACCATTCTAATTGATCTCGAGATCAATTAGAATGGTAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-750s21c1
Sequence:CCGGAGAATAGGACTCAGTTTATATCTCGAGATATAAACTGAGTCCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021529.3-1095s1c1
Sequence:CCGGCATAATGGCATGCTAAGTAAACTCGAGTTTACTTAGCATGCCATTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021529.2-1601s1c1
Sequence:CCGGGCAACACTGTTGAAGCAGAATCTCGAGATTCTGCTTCAACAGTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021529.2-1893s1c1
Sequence:CCGGCCATTGCATTTCTGATTCAAACTCGAGTTTGAATCAGAAATGCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021529.2-1451s1c1
Sequence:CCGGGTCACTACCATTCTAATTGATCTCGAGATCAATTAGAATGGTAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021529.3-710s1c1
Sequence:CCGGCTTTAACTACGTCATGCGAAACTCGAGTTTCGCATGACGTAGTTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021529.3-1563s1c1
Sequence:CCGGGAGAACTCTGCAGATCTTGATCTCGAGATCAAGATCTGCAGAGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-508s21c1
Sequence:CCGGACGAAGAGTTGCAGAACTTATCTCGAGATAAGTTCTGCAACTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-338s21c1
Sequence:CCGGCAAATACTACTCAGAGTGGAACTCGAGTTCCACTCTGAGTAGTATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-694s21c1
Sequence:CCGGTTTCCATCATGCAGTTCTTTACTCGAGTAAAGAACTGCATGATGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021529
VALIDATED
PPP2R3C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B'', gamma
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021529.2-2000s1c1
Sequence:CCGGGCCTTTAACCTTGAACTCTTACTCGAGTAAGAGTTCAAGGTTAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021529.3-509s1c1
Sequence:CCGGCGAAGAGTTGCAGAACTTATGCTCGAGCATAAGTTCTGCAACTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021529.2-301s1c1
Sequence:CCGGCAAATACTACTCAGAGTGGAACTCGAGTTCCACTCTGAGTAGTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-1488s21c1
Sequence:CCGGGTCACTACCATTCTAATTGATCTCGAGATCAATTAGAATGGTAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-750s21c1
Sequence:CCGGAGAATAGGACTCAGTTTATATCTCGAGATATAAACTGAGTCCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021529.3-1095s1c1
Sequence:CCGGCATAATGGCATGCTAAGTAAACTCGAGTTTACTTAGCATGCCATTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021529.2-1601s1c1
Sequence:CCGGGCAACACTGTTGAAGCAGAATCTCGAGATTCTGCTTCAACAGTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021529.2-1893s1c1
Sequence:CCGGCCATTGCATTTCTGATTCAAACTCGAGTTTGAATCAGAAATGCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021529.2-1451s1c1
Sequence:CCGGGTCACTACCATTCTAATTGATCTCGAGATCAATTAGAATGGTAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021529.3-710s1c1
Sequence:CCGGCTTTAACTACGTCATGCGAAACTCGAGTTTCGCATGACGTAGTTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021529.3-1563s1c1
Sequence:CCGGGAGAACTCTGCAGATCTTGATCTCGAGATCAAGATCTGCAGAGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-508s21c1
Sequence:CCGGACGAAGAGTTGCAGAACTTATCTCGAGATAAGTTCTGCAACTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-338s21c1
Sequence:CCGGCAAATACTACTCAGAGTGGAACTCGAGTTCCACTCTGAGTAGTATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-694s21c1
Sequence:CCGGTTTCCATCATGCAGTTCTTTACTCGAGTAAAGAACTGCATGATGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021529
VALIDATED
PPP2R3C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B'', gamma
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021529.2-2000s1c1
Sequence:CCGGGCCTTTAACCTTGAACTCTTACTCGAGTAAGAGTTCAAGGTTAAAGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021529.3-509s1c1
Sequence:CCGGCGAAGAGTTGCAGAACTTATGCTCGAGCATAAGTTCTGCAACTCTTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000191022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021529.2-301s1c1
Sequence:CCGGCAAATACTACTCAGAGTGGAACTCGAGTTCCACTCTGAGTAGTATTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-1488s21c1
Sequence:CCGGGTCACTACCATTCTAATTGATCTCGAGATCAATTAGAATGGTAGTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-750s21c1
Sequence:CCGGAGAATAGGACTCAGTTTATATCTCGAGATATAAACTGAGTCCTATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021529.3-1095s1c1
Sequence:CCGGCATAATGGCATGCTAAGTAAACTCGAGTTTACTTAGCATGCCATTATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021529.2-1601s1c1
Sequence:CCGGGCAACACTGTTGAAGCAGAATCTCGAGATTCTGCTTCAACAGTGTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000191127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021529.2-1893s1c1
Sequence:CCGGCCATTGCATTTCTGATTCAAACTCGAGTTTGAATCAGAAATGCAATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000191960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021529.2-1451s1c1
Sequence:CCGGGTCACTACCATTCTAATTGATCTCGAGATCAATTAGAATGGTAGTGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000215902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021529.3-710s1c1
Sequence:CCGGCTTTAACTACGTCATGCGAAACTCGAGTTTCGCATGACGTAGTTAAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021529.3-1563s1c1
Sequence:CCGGGAGAACTCTGCAGATCTTGATCTCGAGATCAAGATCTGCAGAGTTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-508s21c1
Sequence:CCGGACGAAGAGTTGCAGAACTTATCTCGAGATAAGTTCTGCAACTCTTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-338s21c1
Sequence:CCGGCAAATACTACTCAGAGTGGAACTCGAGTTCCACTCTGAGTAGTATTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021529.3-694s21c1
Sequence:CCGGTTTCCATCATGCAGTTCTTTACTCGAGTAAAGAACTGCATGATGGAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???