EMAIL THIS PAGE TO A FRIEND

PPP2R5A

protein phosphatase 2, regulatory subunit B', alpha

106 Gene Product Result for
Synonyms: B56A PR61A
Gene ID:
Human(5525) Summary: The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B56 subfamily. Alternative transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Mouse(226849) protein phosphatase 2, regulatory subunit B (B56), alpha isoform
Rat(312754) protein phosphatase 2, regulatory subunit B', alpha
Zebrafish(562460) protein phosphatase 2, regulatory subunit B', alpha isoform
domestic cat(101083734) protein phosphatase 2, regulatory subunit B', alpha
dog(490280) protein phosphatase 2, regulatory subunit B', alpha
chicken(421372) protein phosphatase 2, regulatory subunit B', alpha
naked mole-rat(101712512) protein phosphatase 2, regulatory subunit B', alpha
Domestic Rabbit(100346997) protein phosphatase 2, regulatory subunit B', alpha
domestic guinea pig(100723199) protein phosphatase 2, regulatory subunit B', alpha
cow(533788) protein phosphatase 2, regulatory subunit B', alpha
sheep(101117264) protein phosphatase 2, regulatory subunit B', alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C7632 Cantharidin human pricing
N8784 Norcantharidin solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006243 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006243 siRNAs that have been validated in the lab human pricing
NM_001107891 Rosetta Predictions rat pricing
NM_144880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006243 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094478 validated 872
2 SASI_Hs01_00094479 predicted 1193
3 SASI_Hs01_00094480 predicted 1036
4 SASI_Hs01_00094481 predicted 740
5 SASI_Hs01_00094482 predicted 1793
6 SASI_Hs02_00341166 predicted 1353
7 SASI_Hs01_00094483 predicted 909
8 SASI_Hs01_00094484 predicted 894
9 SASI_Hs01_00094485 predicted 1184
10 SASI_Hs01_00094486 predicted 923
11 SASI_Hs01_00094487 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233295 predicted 499
2 SASI_Rn02_00233296 predicted 1404
3 SASI_Rn02_00233297 predicted 1290
4 SASI_Rn02_00233298 predicted 516
5 SASI_Rn02_00233299 predicted 1717
6 SASI_Rn02_00233300 predicted 1589
7 SASI_Rn02_00233301 predicted 1612
8 SASI_Rn02_00233302 predicted 1512
9 SASI_Rn02_00233303 predicted 919
10 SASI_Rn02_00233304 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182762 predicted 792
2 SASI_Mm01_00182764 predicted 1371
3 SASI_Mm02_00340325 predicted 1757
4 SASI_Mm02_00340326 predicted 1294
5 SASI_Mm02_00340327 predicted 791
6 SASI_Mm01_00182769 predicted 1091
7 SASI_Mm01_00182770 predicted 1740
8 SASI_Mm02_00340328 predicted 1097
9 SASI_Mm02_00340329 predicted 1289
10 SASI_Mm02_00340330 predicted 1416
11 SASI_Mm01_00182761 predicted 1123
12 SASI_Mm01_00182763 predicted 1625
13 SASI_Mm01_00182765 predicted 962
14 SASI_Mm01_00182766 predicted 951
15 SASI_Mm01_00182767 predicted 923
16 SASI_Mm01_00182768 predicted 982
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144880
PPP2R5A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B', alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144880.3-2042s1c1
Sequence:CCGGGCTTACAACATGCACAGTATTCTCGAGAATACTGTGCATGTTGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144880.3-1736s1c1
Sequence:CCGGGCACTGTACTTCTGGAATAATCTCGAGATTATTCCAGAAGTACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144880.3-2214s1c1
Sequence:CCGGGCGAAAGAATTATGGACTAAACTCGAGTTTAGTCCATAATTCTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144880.3-1127s1c1
Sequence:CCGGAGATTCTTGGAGAGTCCTGATCTCGAGATCAGGACTCTCCAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144880.3-1094s1c1
Sequence:CCGGCCTCACATACAGTTGGTGTATCTCGAGATACACCAACTGTATGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144880
PPP2R5A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B', alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144880.3-2042s1c1
Sequence:CCGGGCTTACAACATGCACAGTATTCTCGAGAATACTGTGCATGTTGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144880.3-1736s1c1
Sequence:CCGGGCACTGTACTTCTGGAATAATCTCGAGATTATTCCAGAAGTACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144880.3-2214s1c1
Sequence:CCGGGCGAAAGAATTATGGACTAAACTCGAGTTTAGTCCATAATTCTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144880.3-1127s1c1
Sequence:CCGGAGATTCTTGGAGAGTCCTGATCTCGAGATCAGGACTCTCCAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144880.3-1094s1c1
Sequence:CCGGCCTCACATACAGTTGGTGTATCTCGAGATACACCAACTGTATGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144880
PPP2R5A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B', alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144880.3-2042s1c1
Sequence:CCGGGCTTACAACATGCACAGTATTCTCGAGAATACTGTGCATGTTGTAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144880.3-1736s1c1
Sequence:CCGGGCACTGTACTTCTGGAATAATCTCGAGATTATTCCAGAAGTACAGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144880.3-2214s1c1
Sequence:CCGGGCGAAAGAATTATGGACTAAACTCGAGTTTAGTCCATAATTCTTTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144880.3-1127s1c1
Sequence:CCGGAGATTCTTGGAGAGTCCTGATCTCGAGATCAGGACTCTCCAAGAATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000081184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144880.3-1094s1c1
Sequence:CCGGCCTCACATACAGTTGGTGTATCTCGAGATACACCAACTGTATGTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006243
VALIDATED
PPP2R5A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B', alpha
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006243.x-870s1c1
Sequence:CCGGCACTGAATGAACTGGTTGAGTCTCGAGACTCAACCAGTTCATTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006243.2-1800s21c1
Sequence:CCGGCGACCATTGTAGCACTGGTATCTCGAGATACCAGTGCTACAATGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006243.2-959s21c1
Sequence:CCGGGCTAACATCTTCCGTACACTTCTCGAGAAGTGTACGGAAGATGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006243.2-2696s1c1
Sequence:CCGGCAGAGTGGTAACAGATGGGTACTCGAGTACCCATCTGTTACCACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006243.2-959s1c1
Sequence:CCGGGCTAACATCTTCCGTACACTTCTCGAGAAGTGTACGGAAGATGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006243.2-1043s1c1
Sequence:CCGGCCTCACATACAGTTGGTATATCTCGAGATATACCAACTGTATGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006243.2-1800s1c1
Sequence:CCGGCGACCATTGTAGCACTGGTATCTCGAGATACCAGTGCTACAATGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006243.2-758s1c1
Sequence:CCGGGCCACTTCAAATGAACAACAACTCGAGTTGTTGTTCATTTGAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006243.2-873s21c1
Sequence:CCGGCACTGAATGAACTGGTTGAGTCTCGAGACTCAACCAGTTCATTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006243.2-1912s21c1
Sequence:CCGGGAAGGAATTGGAACGTGAAGACTCGAGTCTTCACGTTCCAATTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006243.2-2199s21c1
Sequence:CCGGGTATCATGGCCATAGTATATTCTCGAGAATATACTATGGCCATGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006243
VALIDATED
PPP2R5A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B', alpha
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006243.x-870s1c1
Sequence:CCGGCACTGAATGAACTGGTTGAGTCTCGAGACTCAACCAGTTCATTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006243.2-1800s21c1
Sequence:CCGGCGACCATTGTAGCACTGGTATCTCGAGATACCAGTGCTACAATGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006243.2-959s21c1
Sequence:CCGGGCTAACATCTTCCGTACACTTCTCGAGAAGTGTACGGAAGATGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006243.2-2696s1c1
Sequence:CCGGCAGAGTGGTAACAGATGGGTACTCGAGTACCCATCTGTTACCACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006243.2-959s1c1
Sequence:CCGGGCTAACATCTTCCGTACACTTCTCGAGAAGTGTACGGAAGATGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006243.2-1043s1c1
Sequence:CCGGCCTCACATACAGTTGGTATATCTCGAGATATACCAACTGTATGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006243.2-1800s1c1
Sequence:CCGGCGACCATTGTAGCACTGGTATCTCGAGATACCAGTGCTACAATGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006243.2-758s1c1
Sequence:CCGGGCCACTTCAAATGAACAACAACTCGAGTTGTTGTTCATTTGAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006243.2-873s21c1
Sequence:CCGGCACTGAATGAACTGGTTGAGTCTCGAGACTCAACCAGTTCATTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006243.2-1912s21c1
Sequence:CCGGGAAGGAATTGGAACGTGAAGACTCGAGTCTTCACGTTCCAATTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006243.2-2199s21c1
Sequence:CCGGGTATCATGGCCATAGTATATTCTCGAGAATATACTATGGCCATGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006243
VALIDATED
PPP2R5A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B', alpha
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006243.x-870s1c1
Sequence:CCGGCACTGAATGAACTGGTTGAGTCTCGAGACTCAACCAGTTCATTCAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000331184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006243.2-1800s21c1
Sequence:CCGGCGACCATTGTAGCACTGGTATCTCGAGATACCAGTGCTACAATGGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000298747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006243.2-959s21c1
Sequence:CCGGGCTAACATCTTCCGTACACTTCTCGAGAAGTGTACGGAAGATGTTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000039618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006243.2-2696s1c1
Sequence:CCGGCAGAGTGGTAACAGATGGGTACTCGAGTACCCATCTGTTACCACTCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000039622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006243.2-959s1c1
Sequence:CCGGGCTAACATCTTCCGTACACTTCTCGAGAAGTGTACGGAAGATGTTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000039621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006243.2-1043s1c1
Sequence:CCGGCCTCACATACAGTTGGTATATCTCGAGATATACCAACTGTATGTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000039619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006243.2-1800s1c1
Sequence:CCGGCGACCATTGTAGCACTGGTATCTCGAGATACCAGTGCTACAATGGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000039620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006243.2-758s1c1
Sequence:CCGGGCCACTTCAAATGAACAACAACTCGAGTTGTTGTTCATTTGAAGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000308017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006243.2-873s21c1
Sequence:CCGGCACTGAATGAACTGGTTGAGTCTCGAGACTCAACCAGTTCATTCAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006243.2-1912s21c1
Sequence:CCGGGAAGGAATTGGAACGTGAAGACTCGAGTCTTCACGTTCCAATTCCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000308020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006243.2-2199s21c1
Sequence:CCGGGTATCATGGCCATAGTATATTCTCGAGAATATACTATGGCCATGATACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???