EMAIL THIS PAGE TO A FRIEND

PPP2R5B

protein phosphatase 2, regulatory subunit B', beta

91 Gene Product Result for
Synonyms: B56B PR61B
UniProtKB ID: Q15173, Q13853
Gene ID:
Human(5526) Summary: The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B56 subfamily. [provided by RefSeq, Jul 2008]
Mouse(225849) protein phosphatase 2, regulatory subunit B (B56), beta isoform
Rat(309179) protein phosphatase 2, regulatory subunit B', beta
cow(505915) protein phosphatase 2, regulatory subunit B', beta
Goat(100861365) protein phosphatase 2, regulatory subunit B', beta
sheep(101104699) protein phosphatase 2, regulatory subunit B', beta
domestic guinea pig(100723810) protein phosphatase 2, regulatory subunit B', beta
Domestic Rabbit(100009215) protein phosphatase 2, regulatory subunit B', beta
naked mole-rat(101706140) protein phosphatase 2, regulatory subunit B', beta
domestic cat(101081164) protein phosphatase 2, regulatory subunit B', beta
Horse(100050735) protein phosphatase 2, regulatory subunit B', beta
dog(483755) protein phosphatase 2, regulatory subunit B', beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006244 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006244 Rosetta Predictions human pricing
NM_181379 Rosetta Predictions rat pricing
NM_198168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123731 predicted 1205
2 SASI_Hs02_00341167 predicted 957
3 SASI_Hs02_00341168 predicted 1819
4 SASI_Hs01_00123734 predicted 1441
5 SASI_Hs01_00123735 predicted 1718
6 SASI_Hs01_00123736 predicted 975
7 SASI_Hs01_00123737 predicted 1014
8 SASI_Hs01_00123738 predicted 1725
9 SASI_Hs01_00123739 predicted 1850
10 SASI_Hs01_00123740 predicted 1882
11 SASI_Hs01_00123732 predicted 1878
12 SASI_Hs01_00123733 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102836 predicted 750
2 SASI_Rn02_00269719 predicted 1288
3 SASI_Rn01_00102837 predicted 432
4 SASI_Rn01_00102838 predicted 525
5 SASI_Rn01_00102839 predicted 769
6 SASI_Rn01_00102841 predicted 258
7 SASI_Rn01_00102842 predicted 564
8 SASI_Rn01_00102843 predicted 1344
9 SASI_Rn01_00102844 predicted 405
10 SASI_Rn01_00102845 predicted 906
11 SASI_Rn01_00102840 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031183 predicted 1883
2 SASI_Mm01_00031184 predicted 1174
3 SASI_Mm01_00031185 predicted 1296
4 SASI_Mm01_00031186 predicted 1835
5 SASI_Mm01_00031187 predicted 1083
6 SASI_Mm01_00031188 predicted 981
7 SASI_Mm01_00031189 predicted 1452
8 SASI_Mm01_00031190 predicted 2095
9 SASI_Mm01_00031191 predicted 1180
10 SASI_Mm02_00350878 predicted 732
11 SASI_Mm01_00031192 predicted 1154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198168
VALIDATED
PPP2R5B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B', beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-1328s21c1
Sequence:CCGGACGAGCTGGAACACTTCAATGCTCGAGCATTGAAGTGTTCCAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198168.1-1898s1c1
Sequence:CCGGGAGATGCTAAACCCAGAGCTACTCGAGTAGCTCTGGGTTTAGCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198168.1-767s1c1
Sequence:CCGGCCAGACATCATCCGCATGATACTCGAGTATCATGCGGATGATGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198168.1-1517s1c1
Sequence:CCGGGCTCTGTATTTCTGGAACAATCTCGAGATTGTTCCAGAAATACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198168.1-944s1c1
Sequence:CCGGGCCAAGAGATACGTGGATCAACTCGAGTTGATCCACGTATCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198168.1-1645s1c1
Sequence:CCGGCCTGATCTACAACGTGCTCAACTCGAGTTGAGCACGTTGTAGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-984s21c1
Sequence:CCGGCATCCGCATGATATCAGTAAACTCGAGTTTACTGATATCATGCGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-2312s21c1
Sequence:CCGGGACTAGACCAGGGCAAGTATGCTCGAGCATACTTGCCCTGGTCTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-1084s21c1
Sequence:CCGGCCACATCTGCAGCTGGTATATCTCGAGATATACCAGCTGCAGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-1783s21c1
Sequence:CCGGACTGTGCTGCCTGCGGTATTTCTCGAGAAATACCGCAGGCAGCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198168
VALIDATED
PPP2R5B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B', beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-1328s21c1
Sequence:CCGGACGAGCTGGAACACTTCAATGCTCGAGCATTGAAGTGTTCCAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198168.1-1898s1c1
Sequence:CCGGGAGATGCTAAACCCAGAGCTACTCGAGTAGCTCTGGGTTTAGCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198168.1-767s1c1
Sequence:CCGGCCAGACATCATCCGCATGATACTCGAGTATCATGCGGATGATGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198168.1-1517s1c1
Sequence:CCGGGCTCTGTATTTCTGGAACAATCTCGAGATTGTTCCAGAAATACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198168.1-944s1c1
Sequence:CCGGGCCAAGAGATACGTGGATCAACTCGAGTTGATCCACGTATCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198168.1-1645s1c1
Sequence:CCGGCCTGATCTACAACGTGCTCAACTCGAGTTGAGCACGTTGTAGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-984s21c1
Sequence:CCGGCATCCGCATGATATCAGTAAACTCGAGTTTACTGATATCATGCGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-2312s21c1
Sequence:CCGGGACTAGACCAGGGCAAGTATGCTCGAGCATACTTGCCCTGGTCTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-1084s21c1
Sequence:CCGGCCACATCTGCAGCTGGTATATCTCGAGATATACCAGCTGCAGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-1783s21c1
Sequence:CCGGACTGTGCTGCCTGCGGTATTTCTCGAGAAATACCGCAGGCAGCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198168
VALIDATED
PPP2R5B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B', beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-1328s21c1
Sequence:CCGGACGAGCTGGAACACTTCAATGCTCGAGCATTGAAGTGTTCCAGCTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198168.1-1898s1c1
Sequence:CCGGGAGATGCTAAACCCAGAGCTACTCGAGTAGCTCTGGGTTTAGCATCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198168.1-767s1c1
Sequence:CCGGCCAGACATCATCCGCATGATACTCGAGTATCATGCGGATGATGTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198168.1-1517s1c1
Sequence:CCGGGCTCTGTATTTCTGGAACAATCTCGAGATTGTTCCAGAAATACAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198168.1-944s1c1
Sequence:CCGGGCCAAGAGATACGTGGATCAACTCGAGTTGATCCACGTATCTCTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_198168.1-1645s1c1
Sequence:CCGGCCTGATCTACAACGTGCTCAACTCGAGTTGAGCACGTTGTAGATCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000340538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-984s21c1
Sequence:CCGGCATCCGCATGATATCAGTAAACTCGAGTTTACTGATATCATGCGGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000340540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-2312s21c1
Sequence:CCGGGACTAGACCAGGGCAAGTATGCTCGAGCATACTTGCCCTGGTCTAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000340475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-1084s21c1
Sequence:CCGGCCACATCTGCAGCTGGTATATCTCGAGATATACCAGCTGCAGATGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000352447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_198168.3-1783s21c1
Sequence:CCGGACTGTGCTGCCTGCGGTATTTCTCGAGAAATACCGCAGGCAGCACAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006244
VALIDATED
PPP2R5B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B', beta
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006244.2-2111s21c1
Sequence:CCGGAGAGCTGTCAGTCCCTCTATCCTCGAGGATAGAGGGACTGACAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006244.2-1171s21c1
Sequence:CCGGCTGATGCTCCTGGAGCTATTTCTCGAGAAATAGCTCCAGGAGCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006244.2-975s21c1
Sequence:CCGGCCGCATGATCTCAGTGAATATCTCGAGATATTCACTGAGATCATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006244.2-1835s21c1
Sequence:CCGGTCGTATCACTGATCTACAATGCTCGAGCATTGTAGATCAGTGATACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039933    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006244.2-2642s1c1
Sequence:CCGGGTTCACAGTAATCATGGTCTACTCGAGTAGACCATGATTACTGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006244.2-1141s1c1
Sequence:CCGGGCCAAGAGATATGTGGATCAACTCGAGTTGATCCACATATCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006244.2-1302s1c1
Sequence:CCGGCCTCCGGTTCATCTATGAATTCTCGAGAATTCATAGATGAACCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006244.2-1023s1c1
Sequence:CCGGCCCTGAATTTGACCCTGAAGACTCGAGTCTTCAGGGTCAAATTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006244.2-975s1c1
Sequence:CCGGCCGCATGATCTCAGTGAATATCTCGAGATATTCACTGAGATCATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006244.2-1072s21c1
Sequence:CCGGCCACACCTGCAGCTGGTATATCTCGAGATATACCAGCTGCAGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006244.2-1298s21c1
Sequence:GTACCGGTCTTCCTCCGGTTCATCTATGCTCGAGCATAGATGAACCGGAGGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006244
VALIDATED
PPP2R5B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B', beta
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006244.2-2111s21c1
Sequence:CCGGAGAGCTGTCAGTCCCTCTATCCTCGAGGATAGAGGGACTGACAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006244.2-1171s21c1
Sequence:CCGGCTGATGCTCCTGGAGCTATTTCTCGAGAAATAGCTCCAGGAGCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006244.2-975s21c1
Sequence:CCGGCCGCATGATCTCAGTGAATATCTCGAGATATTCACTGAGATCATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006244.2-1835s21c1
Sequence:CCGGTCGTATCACTGATCTACAATGCTCGAGCATTGTAGATCAGTGATACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039933    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006244.2-2642s1c1
Sequence:CCGGGTTCACAGTAATCATGGTCTACTCGAGTAGACCATGATTACTGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006244.2-1141s1c1
Sequence:CCGGGCCAAGAGATATGTGGATCAACTCGAGTTGATCCACATATCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006244.2-1302s1c1
Sequence:CCGGCCTCCGGTTCATCTATGAATTCTCGAGAATTCATAGATGAACCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006244.2-1023s1c1
Sequence:CCGGCCCTGAATTTGACCCTGAAGACTCGAGTCTTCAGGGTCAAATTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006244.2-975s1c1
Sequence:CCGGCCGCATGATCTCAGTGAATATCTCGAGATATTCACTGAGATCATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006244.2-1072s21c1
Sequence:CCGGCCACACCTGCAGCTGGTATATCTCGAGATATACCAGCTGCAGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006244.2-1298s21c1
Sequence:GTACCGGTCTTCCTCCGGTTCATCTATGCTCGAGCATAGATGAACCGGAGGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006244
VALIDATED
PPP2R5B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B', beta
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006244.2-2111s21c1
Sequence:CCGGAGAGCTGTCAGTCCCTCTATCCTCGAGGATAGAGGGACTGACAGCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006244.2-1171s21c1
Sequence:CCGGCTGATGCTCCTGGAGCTATTTCTCGAGAAATAGCTCCAGGAGCATCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000306732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006244.2-975s21c1
Sequence:CCGGCCGCATGATCTCAGTGAATATCTCGAGATATTCACTGAGATCATGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000307976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006244.2-1835s21c1
Sequence:CCGGTCGTATCACTGATCTACAATGCTCGAGCATTGTAGATCAGTGATACGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000039933    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006244.2-2642s1c1
Sequence:CCGGGTTCACAGTAATCATGGTCTACTCGAGTAGACCATGATTACTGTGAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000039934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006244.2-1141s1c1
Sequence:CCGGGCCAAGAGATATGTGGATCAACTCGAGTTGATCCACATATCTCTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000039936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006244.2-1302s1c1
Sequence:CCGGCCTCCGGTTCATCTATGAATTCTCGAGAATTCATAGATGAACCGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000039937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006244.2-1023s1c1
Sequence:CCGGCCCTGAATTTGACCCTGAAGACTCGAGTCTTCAGGGTCAAATTCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000039935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006244.2-975s1c1
Sequence:CCGGCCGCATGATCTCAGTGAATATCTCGAGATATTCACTGAGATCATGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006244.2-1072s21c1
Sequence:CCGGCCACACCTGCAGCTGGTATATCTCGAGATATACCAGCTGCAGGTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006244.2-1298s21c1
Sequence:GTACCGGTCTTCCTCCGGTTCATCTATGCTCGAGCATAGATGAACCGGAGGAAGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???