EMAIL THIS PAGE TO A FRIEND

PPP2R5D

protein phosphatase 2, regulatory subunit B', delta

151 Gene Product Result for
Synonyms: B56D
Gene ID:
Human(5528) Summary: The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a delta isoform of the regulatory subunit B56 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(21770) protein phosphatase 2, regulatory subunit B (B56), delta isoform
Rat(363193) protein phosphatase 2, regulatory subunit B', delta
Zebrafish(406610) protein phosphatase 2, regulatory subunit B', delta
chicken(421250) protein phosphatase 2, regulatory subunit B', delta
Horse(100054880) protein phosphatase 2, regulatory subunit B', delta
domestic cat(101083266) protein phosphatase 2, regulatory subunit B', delta
dog(481806) protein phosphatase 2, regulatory subunit B', delta
cow(100134966) protein phosphatase 2, regulatory subunit B', delta
sheep(101110885) protein phosphatase 2, regulatory subunit B', delta
domestic guinea pig(100735391) protein phosphatase 2, regulatory subunit B', delta
Domestic Rabbit(100009533) protein phosphatase 2, regulatory subunit B', delta
naked mole-rat(101724057) protein phosphatase 2, regulatory subunit B', delta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
04-639 Anti-PP2A Antibody, B subunit, B56 delta, clone H5D12 clone H5D12, Upstate®, from mouse human
western blot pricing
07-1216 Anti-PP2A Antibody, Catalytic subunit clone, Upstate®, from rabbit bovine, mouse, chicken, human, rat
immunohistochemistry, western blot pricing
SAB4200255 Anti-PP2A subunit B isoform B56-δ antibody, Mouse monoclonal clone H5D12, purified from hybridoma cell culture human, rat
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB2500817 Anti-PPP2R5D antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rabbit
ELISA, western blot pricing
SAB4502308 Anti-PPP2R5D antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
HPA029045 Anti-PPP2R5D antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 Antibody Enhanced Validation rat, human, mouse
immunohistochemistry, western blot pricing
HPA029046 Anti-PPP2R5D antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 Antibody Enhanced Validation mouse, human, rat
immunohistochemistry, western blot pricing
SAB1402322 Monoclonal Anti-PPP2R5D antibody produced in mouse clone 4E12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404235 Monoclonal Anti-PPP2R5D, (C-terminal) antibody produced in mouse clone 1A3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006245 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067721 MISSION® esiRNA targeting human PPP2R5D human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006245 siRNAs that have been validated in the lab human pricing
NM_180976 siRNAs that have been validated in the lab human pricing
NM_180977 siRNAs that have been validated in the lab human pricing
XM_001062510 Rosetta Predictions rat pricing
XM_001065844 Rosetta Predictions rat pricing
NM_009358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006245 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186412 validated 927
2 SASI_Hs01_00186413 predicted 791
3 SASI_Hs01_00186414 predicted 1460
4 SASI_Hs01_00186415 predicted 1248
5 SASI_Hs01_00186416 predicted 903
6 SASI_Hs01_00186417 predicted 658
7 SASI_Hs01_00186418 predicted 763
8 SASI_Hs01_00186419 predicted 700
9 SASI_Hs01_00186420 predicted 1381
10 SASI_Hs01_00186421 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180976 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053785 validated 830
2 SASI_Hs01_00053786 predicted 694
3 SASI_Hs01_00053787 predicted 1362
4 SASI_Hs01_00053788 predicted 1156
5 SASI_Hs01_00053789 predicted 801
6 SASI_Hs01_00053790 predicted 558
7 SASI_Hs01_00053791 predicted 667
8 SASI_Hs01_00053792 predicted 607
9 SASI_Hs01_00053793 predicted 1284
10 SASI_Hs01_00053794 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180977 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027746 validated 604
2 SASI_Hs01_00027747 predicted 476
3 SASI_Hs01_00027748 predicted 1147
4 SASI_Hs01_00027749 predicted 934
5 SASI_Hs01_00027750 predicted 587
6 SASI_Hs01_00027751 predicted 340
7 SASI_Hs01_00027752 predicted 442
8 SASI_Hs01_00027753 predicted 385
9 SASI_Hs01_00027754 predicted 1059
10 SASI_Hs01_00027755 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303714 predicted 747
2 SASI_Rn02_00303715 predicted 336
3 SASI_Rn02_00303716 predicted 476
4 SASI_Rn02_00303717 predicted 792
5 SASI_Rn02_00303718 predicted 987
6 SASI_Rn02_00303719 predicted 1549
7 SASI_Rn02_00303720 predicted 1021
8 SASI_Rn02_00303721 predicted 1023
9 SASI_Rn02_00303722 predicted 1259
10 SASI_Rn02_00303723 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315524 predicted 748
2 SASI_Rn02_00315525 predicted 339
3 SASI_Rn02_00315526 predicted 470
4 SASI_Rn02_00315527 predicted 791
5 SASI_Rn02_00315528 predicted 988
6 SASI_Rn02_00315529 predicted 1554
7 SASI_Rn02_00315530 predicted 1015
8 SASI_Rn02_00315531 predicted 1018
9 SASI_Rn02_00315532 predicted 1259
10 SASI_Rn02_00315533 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082302 predicted 1400
2 SASI_Mm01_00082303 predicted 912
3 SASI_Mm01_00082304 predicted 344
4 SASI_Mm01_00082305 predicted 1438
5 SASI_Mm01_00082306 predicted 1136
6 SASI_Mm01_00082307 predicted 754
7 SASI_Mm01_00082308 predicted 1220
8 SASI_Mm01_00082309 predicted 879
9 SASI_Mm01_00082310 predicted 728
10 SASI_Mm01_00082311 predicted 1051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006245
PPP2R5D MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B', delta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006245.2-709s21c1
Sequence:CCGGCACATCTCCAGCTCGTGTATGCTCGAGCATACACGAGCTGGAGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006245.2-1468s21c1
Sequence:CCGGCAATCCATGGACTGATCTATACTCGAGTATAGATCAGTCCATGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006245.2-807s21c1
Sequence:CCGGCTTGCTCTCCTAGACCTATTTCTCGAGAAATAGGTCTAGGAGAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006245.x-764s1c1
Sequence:CCGGCCAGCCAAACATAGCCAAGAACTCGAGTTCTTGGCTATGTTTGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006245.x-1430s1c1
Sequence:CCGGTGCACTCTACAGGAACTCCAACTCGAGTTGGAGTTCCTGTAGAGTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006245.x-729s1c1
Sequence:CCGGGAGTTCTTCTTACGTTTCCTTCTCGAGAAGGAAACGTAAGAAGAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006245.x-929s1c1
Sequence:CCGGCCACATCTTCTACAGGTTCATCTCGAGATGAACCTGTAGAAGATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006245.2-1152s21c1
Sequence:CCGGAGTCTGACTGAGCCGGTAATTCTCGAGAATTACCGGCTCAGTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006245.x-2492s1c1
Sequence:CCGGGTGGACAATAACTGATGAATACTCGAGTATTCATCAGTTATTGTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006245
PPP2R5D MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B', delta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006245.2-709s21c1
Sequence:CCGGCACATCTCCAGCTCGTGTATGCTCGAGCATACACGAGCTGGAGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006245.2-1468s21c1
Sequence:CCGGCAATCCATGGACTGATCTATACTCGAGTATAGATCAGTCCATGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006245.2-807s21c1
Sequence:CCGGCTTGCTCTCCTAGACCTATTTCTCGAGAAATAGGTCTAGGAGAGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006245.x-764s1c1
Sequence:CCGGCCAGCCAAACATAGCCAAGAACTCGAGTTCTTGGCTATGTTTGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006245.x-1430s1c1
Sequence:CCGGTGCACTCTACAGGAACTCCAACTCGAGTTGGAGTTCCTGTAGAGTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006245.x-729s1c1
Sequence:CCGGGAGTTCTTCTTACGTTTCCTTCTCGAGAAGGAAACGTAAGAAGAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006245.x-929s1c1
Sequence:CCGGCCACATCTTCTACAGGTTCATCTCGAGATGAACCTGTAGAAGATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006245.2-1152s21c1
Sequence:CCGGAGTCTGACTGAGCCGGTAATTCTCGAGAATTACCGGCTCAGTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006245.x-2492s1c1
Sequence:CCGGGTGGACAATAACTGATGAATACTCGAGTATTCATCAGTTATTGTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006245
PPP2R5D MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B', delta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006245.2-709s21c1
Sequence:CCGGCACATCTCCAGCTCGTGTATGCTCGAGCATACACGAGCTGGAGATGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006245.2-1468s21c1
Sequence:CCGGCAATCCATGGACTGATCTATACTCGAGTATAGATCAGTCCATGGATTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000355971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006245.2-807s21c1
Sequence:CCGGCTTGCTCTCCTAGACCTATTTCTCGAGAAATAGGTCTAGGAGAGCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006245.x-764s1c1
Sequence:CCGGCCAGCCAAACATAGCCAAGAACTCGAGTTCTTGGCTATGTTTGGCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006245.x-1430s1c1
Sequence:CCGGTGCACTCTACAGGAACTCCAACTCGAGTTGGAGTTCCTGTAGAGTGCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006245.x-729s1c1
Sequence:CCGGGAGTTCTTCTTACGTTTCCTTCTCGAGAAGGAAACGTAAGAAGAACTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006245.x-929s1c1
Sequence:CCGGCCACATCTTCTACAGGTTCATCTCGAGATGAACCTGTAGAAGATGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000367676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006245.2-1152s21c1
Sequence:CCGGAGTCTGACTGAGCCGGTAATTCTCGAGAATTACCGGCTCAGTCAGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000002555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006245.x-2492s1c1
Sequence:CCGGGTGGACAATAACTGATGAATACTCGAGTATTCATCAGTTATTGTCCACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009358
VALIDATED
PPP2R5D MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B', delta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-1453s21c1
Sequence:CCGGTCATGTTTCCTGCACTCTATACTCGAGTATAGAGTGCAGGAAACATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-905s21c1
Sequence:CCGGGCATCGCATCTATGGCAAGTTCTCGAGAACTTGCCATAGATGCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-2211s21c1
Sequence:CCGGCCTGAAACTGTTCTGAGAAATCTCGAGATTTCTCAGAACAGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-1383s21c1
Sequence:CCGGGCCCTCTACTACTGGAACAATCTCGAGATTGTTCCAGTAGTAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-869s21c1
Sequence:CCGGAGACCCTAGAGAGCGGGATTTCTCGAGAAATCCCGCTCTCTAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-2157s1c1
Sequence:CCGGCCTGAAACTGTTCTGAGAAATCTCGAGATTTCTCAGAACAGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-742s1c1
Sequence:CCGGCCAGCCAAATATAGCCAAGAACTCGAGTTCTTGGCTATATTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-1328s1c1
Sequence:CCGGGCCCTCTACTACTGGAACAATCTCGAGATTGTTCCAGTAGTAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-851s1c1
Sequence:CCGGCATCGCATCTATGGCAAGTTTCTCGAGAAACTTGCCATAGATGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-850s1c1
Sequence:CCGGGCATCGCATCTATGGCAAGTTCTCGAGAACTTGCCATAGATGCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009358
VALIDATED
PPP2R5D MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B', delta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-1453s21c1
Sequence:CCGGTCATGTTTCCTGCACTCTATACTCGAGTATAGAGTGCAGGAAACATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-905s21c1
Sequence:CCGGGCATCGCATCTATGGCAAGTTCTCGAGAACTTGCCATAGATGCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-2211s21c1
Sequence:CCGGCCTGAAACTGTTCTGAGAAATCTCGAGATTTCTCAGAACAGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-1383s21c1
Sequence:CCGGGCCCTCTACTACTGGAACAATCTCGAGATTGTTCCAGTAGTAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-869s21c1
Sequence:CCGGAGACCCTAGAGAGCGGGATTTCTCGAGAAATCCCGCTCTCTAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-2157s1c1
Sequence:CCGGCCTGAAACTGTTCTGAGAAATCTCGAGATTTCTCAGAACAGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-742s1c1
Sequence:CCGGCCAGCCAAATATAGCCAAGAACTCGAGTTCTTGGCTATATTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-1328s1c1
Sequence:CCGGGCCCTCTACTACTGGAACAATCTCGAGATTGTTCCAGTAGTAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-851s1c1
Sequence:CCGGCATCGCATCTATGGCAAGTTTCTCGAGAAACTTGCCATAGATGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-850s1c1
Sequence:CCGGGCATCGCATCTATGGCAAGTTCTCGAGAACTTGCCATAGATGCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009358
VALIDATED
PPP2R5D MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B', delta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-1453s21c1
Sequence:CCGGTCATGTTTCCTGCACTCTATACTCGAGTATAGAGTGCAGGAAACATGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000325682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-905s21c1
Sequence:CCGGGCATCGCATCTATGGCAAGTTCTCGAGAACTTGCCATAGATGCGATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000325753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-2211s21c1
Sequence:CCGGCCTGAAACTGTTCTGAGAAATCTCGAGATTTCTCAGAACAGTTTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-1383s21c1
Sequence:CCGGGCCCTCTACTACTGGAACAATCTCGAGATTGTTCCAGTAGTAGAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000306033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009358.3-869s21c1
Sequence:CCGGAGACCCTAGAGAGCGGGATTTCTCGAGAAATCCCGCTCTCTAGGGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-2157s1c1
Sequence:CCGGCCTGAAACTGTTCTGAGAAATCTCGAGATTTCTCAGAACAGTTTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-742s1c1
Sequence:CCGGCCAGCCAAATATAGCCAAGAACTCGAGTTCTTGGCTATATTTGGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-1328s1c1
Sequence:CCGGGCCCTCTACTACTGGAACAATCTCGAGATTGTTCCAGTAGTAGAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-851s1c1
Sequence:CCGGCATCGCATCTATGGCAAGTTTCTCGAGAAACTTGCCATAGATGCGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009358.2-850s1c1
Sequence:CCGGGCATCGCATCTATGGCAAGTTCTCGAGAACTTGCCATAGATGCGATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???