EMAIL THIS PAGE TO A FRIEND

PPP2R5E

protein phosphatase 2, regulatory subunit B', epsilon isoform

170 Gene Product Result for
UniProtKB ID: Q16537, A4FU37, B7ZKK8, Q52LW4
Gene ID:
Human(5529) Summary: The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an epsilon isoform of the regulatory subunit B56 subfamily. [provided by RefSeq, Jul 2008]
Mouse(26932) protein phosphatase 2, regulatory subunit B (B56), epsilon isoform
Rat(299147) protein phosphatase 2, regulatory subunit B', epsilon isoform
naked mole-rat(101711583) protein phosphatase 2, regulatory subunit B', epsilon isoform
Domestic Rabbit(100009434) protein phosphatase 2, regulatory subunit B', epsilon isoform
domestic guinea pig(100727229) protein phosphatase 2, regulatory subunit B', epsilon isoform
cow(533617) protein phosphatase 2, regulatory subunit B', epsilon isoform
sheep(101107792) protein phosphatase 2, regulatory subunit B', epsilon isoform
chicken(423512) protein phosphatase 2, regulatory subunit B', epsilon isoform
Horse(100051948) protein phosphatase 2, regulatory subunit B', epsilon isoform
domestic cat(101085293) protein phosphatase 2, regulatory subunit B', epsilon isoform
dog(480349) protein phosphatase 2, regulatory subunit B', epsilon isoform
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006246 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006246 siRNAs that have been validated in the lab human pricing
NM_001106740 Rosetta Predictions rat pricing
NM_012024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006246 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061041 validated 1349
2 SASI_Hs01_00061042 predicted 926
3 SASI_Hs01_00061044 predicted 1728
4 SASI_Hs01_00061045 predicted 1213
5 SASI_Hs02_00341169 predicted 939
6 SASI_Hs01_00061046 predicted 1265
7 SASI_Hs01_00061047 predicted 1578
8 SASI_Hs02_00341170 predicted 1578
9 SASI_Hs01_00061048 predicted 1464
10 SASI_Hs01_00061049 predicted 1788
11 SASI_Hs01_00061040 predicted 1387
12 SASI_Hs01_00061043 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221928 predicted 1617
2 SASI_Rn02_00221929 predicted 1491
3 SASI_Rn02_00221930 predicted 882
4 SASI_Rn02_00221931 predicted 1246
5 SASI_Rn02_00221932 predicted 1415
6 SASI_Rn02_00221933 predicted 1057
7 SASI_Rn02_00221934 predicted 1786
8 SASI_Rn02_00221935 predicted 644
9 SASI_Rn02_00221936 predicted 652
10 SASI_Rn02_00221937 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184222 predicted 910
2 SASI_Mm01_00184223 predicted 1643
3 SASI_Mm01_00184224 predicted 1706
4 SASI_Mm01_00184225 predicted 1244
5 SASI_Mm01_00184226 predicted 1345
6 SASI_Mm01_00184227 predicted 1943
7 SASI_Mm01_00184228 predicted 1284
8 SASI_Mm01_00184229 predicted 1096
9 SASI_Mm01_00184230 predicted 1335
10 SASI_Mm01_00184231 predicted 844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006246
VALIDATED
PPP2R5E MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B', epsilon isoform
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006246.x-677s1c1
Sequence:CCGGGTCGCAAAGTTCCTCACAGTTCTCGAGAACTGTGAGGAACTTTGCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006246.x-927s1c1
Sequence:CCGGCCTGAAGTAGTTAGAATGGTACTCGAGTACCATTCTAACTACTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006246.x-2461s1c1
Sequence:CCGGCCTCTGGATAACTTGACTGTACTCGAGTACAGTCAAGTTATCCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006246.x-972s1c1
Sequence:CCGGCCTCCTAGTGACAGCAATGAACTCGAGTTCATTGCTGTCACTAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006246.x-1200s1c1
Sequence:CCGGCACAGAATTTATGGCAAGTTTCTCGAGAAACTTGCCATAAATTCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006246.2-1168s21c1
Sequence:CCGGCTCGGGAACGGGACTACTTAACTCGAGTTAAGTAGTCCCGTTCCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006246.2-927s21c1
Sequence:CCGGCCTGAAGTAGTTAGAATGGTACTCGAGTACCATTCTAACTACTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006246.2-972s21c1
Sequence:CCGGCCTCCTAGTGACAGCAATGAACTCGAGTTCATTGCTGTCACTAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006246.2-2461s21c1
Sequence:CCGGCCTCTGGATAACTTGACTGTACTCGAGTACAGTCAAGTTATCCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006246.2-1480s21c1
Sequence:CCGGCACTCACAGAACCAGTTATTACTCGAGTAATAACTGGTTCTGTGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006246
VALIDATED
PPP2R5E MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B', epsilon isoform
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006246.x-677s1c1
Sequence:CCGGGTCGCAAAGTTCCTCACAGTTCTCGAGAACTGTGAGGAACTTTGCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006246.x-927s1c1
Sequence:CCGGCCTGAAGTAGTTAGAATGGTACTCGAGTACCATTCTAACTACTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006246.x-2461s1c1
Sequence:CCGGCCTCTGGATAACTTGACTGTACTCGAGTACAGTCAAGTTATCCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006246.x-972s1c1
Sequence:CCGGCCTCCTAGTGACAGCAATGAACTCGAGTTCATTGCTGTCACTAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006246.x-1200s1c1
Sequence:CCGGCACAGAATTTATGGCAAGTTTCTCGAGAAACTTGCCATAAATTCTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006246.2-1168s21c1
Sequence:CCGGCTCGGGAACGGGACTACTTAACTCGAGTTAAGTAGTCCCGTTCCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006246.2-927s21c1
Sequence:CCGGCCTGAAGTAGTTAGAATGGTACTCGAGTACCATTCTAACTACTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006246.2-972s21c1
Sequence:CCGGCCTCCTAGTGACAGCAATGAACTCGAGTTCATTGCTGTCACTAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006246.2-2461s21c1
Sequence:CCGGCCTCTGGATAACTTGACTGTACTCGAGTACAGTCAAGTTATCCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006246.2-1480s21c1
Sequence:CCGGCACTCACAGAACCAGTTATTACTCGAGTAATAACTGGTTCTGTGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006246
VALIDATED
PPP2R5E MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B', epsilon isoform
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006246.x-677s1c1
Sequence:CCGGGTCGCAAAGTTCCTCACAGTTCTCGAGAACTGTGAGGAACTTTGCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006246.x-927s1c1
Sequence:CCGGCCTGAAGTAGTTAGAATGGTACTCGAGTACCATTCTAACTACTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006246.x-2461s1c1
Sequence:CCGGCCTCTGGATAACTTGACTGTACTCGAGTACAGTCAAGTTATCCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006246.x-972s1c1
Sequence:CCGGCCTCCTAGTGACAGCAATGAACTCGAGTTCATTGCTGTCACTAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006246.x-1200s1c1
Sequence:CCGGCACAGAATTTATGGCAAGTTTCTCGAGAAACTTGCCATAAATTCTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006246.2-1168s21c1
Sequence:CCGGCTCGGGAACGGGACTACTTAACTCGAGTTAAGTAGTCCCGTTCCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006246.2-927s21c1
Sequence:CCGGCCTGAAGTAGTTAGAATGGTACTCGAGTACCATTCTAACTACTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006246.2-972s21c1
Sequence:CCGGCCTCCTAGTGACAGCAATGAACTCGAGTTCATTGCTGTCACTAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006246.2-2461s21c1
Sequence:CCGGCCTCTGGATAACTTGACTGTACTCGAGTACAGTCAAGTTATCCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006246.2-1480s21c1
Sequence:CCGGCACTCACAGAACCAGTTATTACTCGAGTAATAACTGGTTCTGTGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012024
PPP2R5E MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B', epsilon isoform
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012024.2-2114s1c1
Sequence:CCGGCCTGTCTCTAAGTAAAGGAAACTCGAGTTTCCTTTACTTAGAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012024.2-751s1c1
Sequence:CCGGCCTGAACTGTTCCTAAAGAAACTCGAGTTTCTTTAGGAACAGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012024.2-805s1c1
Sequence:CCGGGACACGCTATCTGATCTTAAACTCGAGTTTAAGATCAGATAGCGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012024.2-1209s1c1
Sequence:CCGGGCTTAGAGCATTTATCCGAAACTCGAGTTTCGGATAAATGCTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012024.2-1739s1c1
Sequence:CCGGCCAGCCTTTATAGGATTTCAACTCGAGTTGAAATCCTATAAAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012024.2-1948s21c1
Sequence:CCGGCTTAGACGCGATGGGATAATTCTCGAGAATTATCCCATCGCGTCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012024.2-2442s21c1
Sequence:CCGGGACATGACTGTAACGTGATATCTCGAGATATCACGTTACAGTCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012024
PPP2R5E MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B', epsilon isoform
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012024.2-2114s1c1
Sequence:CCGGCCTGTCTCTAAGTAAAGGAAACTCGAGTTTCCTTTACTTAGAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012024.2-751s1c1
Sequence:CCGGCCTGAACTGTTCCTAAAGAAACTCGAGTTTCTTTAGGAACAGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012024.2-805s1c1
Sequence:CCGGGACACGCTATCTGATCTTAAACTCGAGTTTAAGATCAGATAGCGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012024.2-1209s1c1
Sequence:CCGGGCTTAGAGCATTTATCCGAAACTCGAGTTTCGGATAAATGCTCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012024.2-1739s1c1
Sequence:CCGGCCAGCCTTTATAGGATTTCAACTCGAGTTGAAATCCTATAAAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012024.2-1948s21c1
Sequence:CCGGCTTAGACGCGATGGGATAATTCTCGAGAATTATCCCATCGCGTCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012024.2-2442s21c1
Sequence:CCGGGACATGACTGTAACGTGATATCTCGAGATATCACGTTACAGTCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012024
PPP2R5E MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B', epsilon isoform
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012024.2-2114s1c1
Sequence:CCGGCCTGTCTCTAAGTAAAGGAAACTCGAGTTTCCTTTACTTAGAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012024.2-751s1c1
Sequence:CCGGCCTGAACTGTTCCTAAAGAAACTCGAGTTTCTTTAGGAACAGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012024.2-805s1c1
Sequence:CCGGGACACGCTATCTGATCTTAAACTCGAGTTTAAGATCAGATAGCGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012024.2-1209s1c1
Sequence:CCGGGCTTAGAGCATTTATCCGAAACTCGAGTTTCGGATAAATGCTCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012024.2-1739s1c1
Sequence:CCGGCCAGCCTTTATAGGATTTCAACTCGAGTTGAAATCCTATAAAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012024.2-1948s21c1
Sequence:CCGGCTTAGACGCGATGGGATAATTCTCGAGAATTATCCCATCGCGTCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012024.2-2442s21c1
Sequence:CCGGGACATGACTGTAACGTGATATCTCGAGATATCACGTTACAGTCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)