EMAIL THIS PAGE TO A FRIEND

PPP3CA

protein phosphatase 3, catalytic subunit, alpha isozyme

200 Gene Product Result for
Synonyms: CALN CALNA CALNA1 CCN1 CNA1 PPP2B
UniProtKB ID: Q08209, A8K3B7, A8W6Z7, B5BUA2, Q8TAW9
Gene ID:
Mouse(19055) protein phosphatase 3, catalytic subunit, alpha isoform
Rat(24674) protein phosphatase 3, catalytic subunit, alpha isozyme
Zebrafish(794574) protein phosphatase 3, catalytic subunit, alpha isozyme
Horse(100067434) protein phosphatase 3, catalytic subunit, alpha isozyme
domestic cat(101097144) protein phosphatase 3, catalytic subunit, alpha isozyme
chicken(395113) protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform
dog(403486) protein phosphatase 3, catalytic subunit, alpha isozyme
cow(286852) protein phosphatase 3, catalytic subunit, alpha isozyme
sheep(101122602) protein phosphatase 3, catalytic subunit, alpha isozyme
domestic guinea pig(100728974) protein phosphatase 3, catalytic subunit, alpha isozyme
naked mole-rat(101698959) protein phosphatase 3, catalytic subunit, alpha isozyme
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C3662 Cyclosporin A from Tolypocladium inflatum, ≥95% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000944 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000944 Rosetta Predictions human pricing
NM_017041 Rosetta Predictions rat pricing
NM_008913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117458 predicted 1753
2 SASI_Hs01_00117459 predicted 1070
3 SASI_Hs01_00117460 predicted 1417
4 SASI_Hs02_00303553 predicted 768
5 SASI_Hs01_00117461 predicted 1589
6 SASI_Hs01_00117462 predicted 676
7 SASI_Hs02_00303554 predicted 1281
8 SASI_Hs01_00117464 predicted 1217
9 SASI_Hs01_00117466 predicted 1405
10 SASI_Hs01_00117467 predicted 1183
11 SASI_Hs01_00117463 predicted 1146
12 SASI_Hs01_00117465 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118036 predicted 1010
2 SASI_Rn01_00118037 predicted 582
3 SASI_Rn01_00118038 predicted 407
4 SASI_Rn01_00118039 predicted 872
5 SASI_Rn01_00118040 predicted 1530
6 SASI_Rn01_00118041 predicted 1131
7 SASI_Rn01_00118042 predicted 1283
8 SASI_Rn01_00118043 predicted 1306
9 SASI_Rn01_00118044 predicted 721
10 SASI_Rn01_00118045 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109134 predicted 450
2 SASI_Mm01_00109135 predicted 275
3 SASI_Mm01_00109137 predicted 877
4 SASI_Mm02_00314941 predicted 668
5 SASI_Mm01_00109138 predicted 994
6 SASI_Mm01_00109139 predicted 586
7 SASI_Mm02_00314942 predicted 807
8 SASI_Mm01_00109140 predicted 832
9 SASI_Mm01_00109141 predicted 544
10 SASI_Mm01_00109142 predicted 1023
11 SASI_Mm01_00109133 predicted 464
12 SASI_Mm01_00109136 predicted 1161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000944
VALIDATED
PPP3CA MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 3, catalytic subunit, alpha isozyme
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000944.4-1864s21c1
Sequence:GTACCGGAGGAACAAGATCCGAGCAATACTCGAGTATTGCTCGGATCTTGTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000944.4-1181s21c1
Sequence:GTACCGGAGTATTCAGAACGCGTATATGCTCGAGCATATACGCGTTCTGAATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000944.4-1065s21c1
Sequence:CCGGGCTGTATTTGTGGGCCTTGAACTCGAGTTCAAGGCCCACAAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000944.4-2508s21c1
Sequence:CCGGGAAAGCTAATGCTAGTATATACTCGAGTATATACTAGCATTAGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000944.4-2094s21c1
Sequence:CCGGCAAGGGCTTAGACCGAATTAACTCGAGTTAATTCGGTCTAAGCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000944.4-868s21c1
Sequence:CCGGATAACAGAGGGTGCATCAATTCTCGAGAATTGATGCACCCTCTGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000944.4-807s21c1
Sequence:CCGGTATCTTAAAGGCGCATCTTATCTCGAGATAAGATGCGCCTTTAAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000944.x-1791s1c1
Sequence:CCGGCACCACAACATAAGATCACTACTCGAGTAGTGATCTTATGTTGTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000944.x-932s1c1
Sequence:CCGGGATGCCTGTATGGATGCCTTTCTCGAGAAAGGCATCCATACAGGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000944.x-3961s1c1
Sequence:CCGGCGAAGATTTAAGATACACCAACTCGAGTTGGTGTATCTTAAATCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000944.x-594s1c1
Sequence:CCGGGAATAATAACAGAGGGTGCATCTCGAGATGCACCCTCTGTTATTATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000944.x-796s1c1
Sequence:CCGGGCTGTATTTGTGGGCCTTGAACTCGAGTTCAAGGCCCACAAATACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000944
VALIDATED
PPP3CA MISSION shRNA shRNA Plasmid DNA
protein phosphatase 3, catalytic subunit, alpha isozyme
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000944.4-1864s21c1
Sequence:GTACCGGAGGAACAAGATCCGAGCAATACTCGAGTATTGCTCGGATCTTGTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000944.4-1181s21c1
Sequence:GTACCGGAGTATTCAGAACGCGTATATGCTCGAGCATATACGCGTTCTGAATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000944.4-1065s21c1
Sequence:CCGGGCTGTATTTGTGGGCCTTGAACTCGAGTTCAAGGCCCACAAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000944.4-2508s21c1
Sequence:CCGGGAAAGCTAATGCTAGTATATACTCGAGTATATACTAGCATTAGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000944.4-2094s21c1
Sequence:CCGGCAAGGGCTTAGACCGAATTAACTCGAGTTAATTCGGTCTAAGCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000944.4-868s21c1
Sequence:CCGGATAACAGAGGGTGCATCAATTCTCGAGAATTGATGCACCCTCTGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000944.4-807s21c1
Sequence:CCGGTATCTTAAAGGCGCATCTTATCTCGAGATAAGATGCGCCTTTAAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000944.x-1791s1c1
Sequence:CCGGCACCACAACATAAGATCACTACTCGAGTAGTGATCTTATGTTGTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000944.x-932s1c1
Sequence:CCGGGATGCCTGTATGGATGCCTTTCTCGAGAAAGGCATCCATACAGGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000944.x-3961s1c1
Sequence:CCGGCGAAGATTTAAGATACACCAACTCGAGTTGGTGTATCTTAAATCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000944.x-594s1c1
Sequence:CCGGGAATAATAACAGAGGGTGCATCTCGAGATGCACCCTCTGTTATTATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000944.x-796s1c1
Sequence:CCGGGCTGTATTTGTGGGCCTTGAACTCGAGTTCAAGGCCCACAAATACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000944
VALIDATED
PPP3CA MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 3, catalytic subunit, alpha isozyme
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000944.4-1864s21c1
Sequence:GTACCGGAGGAACAAGATCCGAGCAATACTCGAGTATTGCTCGGATCTTGTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000944.4-1181s21c1
Sequence:GTACCGGAGTATTCAGAACGCGTATATGCTCGAGCATATACGCGTTCTGAATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000944.4-1065s21c1
Sequence:CCGGGCTGTATTTGTGGGCCTTGAACTCGAGTTCAAGGCCCACAAATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000944.4-2508s21c1
Sequence:CCGGGAAAGCTAATGCTAGTATATACTCGAGTATATACTAGCATTAGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000944.4-2094s21c1
Sequence:CCGGCAAGGGCTTAGACCGAATTAACTCGAGTTAATTCGGTCTAAGCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000944.4-868s21c1
Sequence:CCGGATAACAGAGGGTGCATCAATTCTCGAGAATTGATGCACCCTCTGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000944.4-807s21c1
Sequence:CCGGTATCTTAAAGGCGCATCTTATCTCGAGATAAGATGCGCCTTTAAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000944.x-1791s1c1
Sequence:CCGGCACCACAACATAAGATCACTACTCGAGTAGTGATCTTATGTTGTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000944.x-932s1c1
Sequence:CCGGGATGCCTGTATGGATGCCTTTCTCGAGAAAGGCATCCATACAGGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000944.x-3961s1c1
Sequence:CCGGCGAAGATTTAAGATACACCAACTCGAGTTGGTGTATCTTAAATCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000944.x-594s1c1
Sequence:CCGGGAATAATAACAGAGGGTGCATCTCGAGATGCACCCTCTGTTATTATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000944.x-796s1c1
Sequence:CCGGGCTGTATTTGTGGGCCTTGAACTCGAGTTCAAGGCCCACAAATACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008913
VALIDATED
PPP3CA MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 3, catalytic subunit, alpha isozyme
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008913.4-1553s21c1
Sequence:CCGGCGCCAACCTTAACTCCATCAACTCGAGTTGATGGAGTTAAGGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008913.4-542s21c1
Sequence:CCGGCACAGAGTATTTCACGTTTAACTCGAGTTAAACGTGAAATACTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008913.1-885s1c1
Sequence:CCGGGCACAATAATTTGTTGTCCATCTCGAGATGGACAACAAATTATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008913.1-543s1c1
Sequence:CCGGCACAGAGTATTTCACGTTTAACTCGAGTTAAACGTGAAATACTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008913.1-240s1c1
Sequence:CCGGGCTGGAAGAAAGTGTTGCATTCTCGAGAATGCAACACTTTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008913.1-1554s1c1
Sequence:CCGGCGCCAACCTTAACTCCATCAACTCGAGTTGATGGAGTTAAGGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008913.1-1751s1c1
Sequence:CCGGGCCAGGAATTGGATTCAGTTTCTCGAGAAACTGAATCCAATTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008913.4-1749s21c1
Sequence:CCGGGCCAGGAATTGGATTCAGTTTCTCGAGAAACTGAATCCAATTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008913.4-239s21c1
Sequence:CCGGGCTGGAAGAAAGTGTTGCATTCTCGAGAATGCAACACTTTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008913
VALIDATED
PPP3CA MISSION shRNA shRNA Plasmid DNA
protein phosphatase 3, catalytic subunit, alpha isozyme
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008913.4-1553s21c1
Sequence:CCGGCGCCAACCTTAACTCCATCAACTCGAGTTGATGGAGTTAAGGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008913.4-542s21c1
Sequence:CCGGCACAGAGTATTTCACGTTTAACTCGAGTTAAACGTGAAATACTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008913.1-885s1c1
Sequence:CCGGGCACAATAATTTGTTGTCCATCTCGAGATGGACAACAAATTATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008913.1-543s1c1
Sequence:CCGGCACAGAGTATTTCACGTTTAACTCGAGTTAAACGTGAAATACTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008913.1-240s1c1
Sequence:CCGGGCTGGAAGAAAGTGTTGCATTCTCGAGAATGCAACACTTTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008913.1-1554s1c1
Sequence:CCGGCGCCAACCTTAACTCCATCAACTCGAGTTGATGGAGTTAAGGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008913.1-1751s1c1
Sequence:CCGGGCCAGGAATTGGATTCAGTTTCTCGAGAAACTGAATCCAATTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008913.4-1749s21c1
Sequence:CCGGGCCAGGAATTGGATTCAGTTTCTCGAGAAACTGAATCCAATTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008913.4-239s21c1
Sequence:CCGGGCTGGAAGAAAGTGTTGCATTCTCGAGAATGCAACACTTTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008913
VALIDATED
PPP3CA MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 3, catalytic subunit, alpha isozyme
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008913.4-1553s21c1
Sequence:CCGGCGCCAACCTTAACTCCATCAACTCGAGTTGATGGAGTTAAGGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008913.4-542s21c1
Sequence:CCGGCACAGAGTATTTCACGTTTAACTCGAGTTAAACGTGAAATACTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008913.1-885s1c1
Sequence:CCGGGCACAATAATTTGTTGTCCATCTCGAGATGGACAACAAATTATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008913.1-543s1c1
Sequence:CCGGCACAGAGTATTTCACGTTTAACTCGAGTTAAACGTGAAATACTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008913.1-240s1c1
Sequence:CCGGGCTGGAAGAAAGTGTTGCATTCTCGAGAATGCAACACTTTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008913.1-1554s1c1
Sequence:CCGGCGCCAACCTTAACTCCATCAACTCGAGTTGATGGAGTTAAGGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008913.1-1751s1c1
Sequence:CCGGGCCAGGAATTGGATTCAGTTTCTCGAGAAACTGAATCCAATTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008913.4-1749s21c1
Sequence:CCGGGCCAGGAATTGGATTCAGTTTCTCGAGAAACTGAATCCAATTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008913.4-239s21c1
Sequence:CCGGGCTGGAAGAAAGTGTTGCATTCTCGAGAATGCAACACTTTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)