EMAIL THIS PAGE TO A FRIEND

PPP3CC

protein phosphatase 3, catalytic subunit, gamma isozyme

76 Gene Product Result for
Synonyms: CALNA3 CNA3 PP2Bgamma
UniProtKB ID: P48454, B4DRT5, Q9BSS6, Q9H4M5
Gene ID:
Human(5533) Summary: Calcineurin is a calcium-dependent, calmodulin-stimulated protein phosphatase involved in the downstream regulation of dopaminergic signal transduction. Calcineurin is composed of a regulatory subunit and a catalytic subunit. The protein encoded by this gene represents one of the regulatory subunits that has been found for calcineurin. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(19057) protein phosphatase 3, catalytic subunit, gamma isoform
Rat(171378) protein phosphatase 3, catalytic subunit, gamma isozyme
dog(609027) protein phosphatase 3, catalytic subunit, gamma isozyme
domestic cat(101093097) protein phosphatase 3, catalytic subunit, gamma isozyme
cow(533527) protein phosphatase 3, catalytic subunit, gamma isozyme
sheep(101115429) protein phosphatase 3, catalytic subunit, gamma isozyme
domestic guinea pig(100727741) protein phosphatase 3, catalytic subunit, gamma isozyme
Domestic Rabbit(100009423) protein phosphatase 3, catalytic subunit, gamma isozyme
naked mole-rat(101719947) protein phosphatase 3, catalytic subunit, gamma isozyme
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C3662 Cyclosporin A from Tolypocladium inflatum, ≥95% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005605 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005605 siRNAs that have been validated in the lab human pricing
NM_134367 Rosetta Predictions rat pricing
NM_008915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005605 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141251 validated 1158
1 SASI_Hs01_00141252 validated 590
1 SASI_Hs01_00141253 validated 1237
2 SASI_Hs01_00141254 predicted 1091
3 SASI_Hs01_00141255 predicted 430
4 SASI_Hs01_00141257 predicted 835
5 SASI_Hs01_00141259 predicted 1845
6 SASI_Hs02_00339920 predicted 410
7 SASI_Hs01_00141260 predicted 1033
8 SASI_Hs02_00339921 predicted 874
9 SASI_Hs01_00141256 predicted 924
10 SASI_Hs01_00141258 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061132 predicted 1001
2 SASI_Rn01_00061133 predicted 1179
3 SASI_Rn01_00061134 predicted 698
4 SASI_Rn02_00267931 predicted 638
5 SASI_Rn01_00061135 predicted 568
6 SASI_Rn01_00061136 predicted 541
7 SASI_Rn01_00061137 predicted 709
8 SASI_Rn01_00061138 predicted 1486
9 SASI_Rn01_00061139 predicted 1312
10 SASI_Rn01_00061140 predicted 1194
11 SASI_Rn01_00061141 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032413 predicted 1137
2 SASI_Mm01_00032414 predicted 387
3 SASI_Mm02_00314946 predicted 1011
4 SASI_Mm01_00032415 predicted 1292
5 SASI_Mm01_00032416 predicted 1309
6 SASI_Mm02_00314947 predicted 588
7 SASI_Mm01_00032418 predicted 692
8 SASI_Mm01_00032419 predicted 833
9 SASI_Mm01_00032420 predicted 767
10 SASI_Mm02_00314948 predicted 662
11 SASI_Mm01_00032417 predicted 1016
12 SASI_Mm01_00032421 predicted 1623
13 SASI_Mm01_00032422 predicted 743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005605
VALIDATED
PPP3CC MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 3, catalytic subunit, gamma isozyme
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005605.3-1961s21c1
Sequence:GTACCGGCAACCTGGAGGTGCATTTATACTCGAGTATAAATGCACCTCCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-625s21c1
Sequence:CCGGGTTGGAGGATCACCTAGTAACCTCGAGGTTACTAGGTGATCCTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-592s21c1
Sequence:CCGGGGACAATTCTTTGACCTAATGCTCGAGCATTAGGTCAAAGAATTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-1728s21c1
Sequence:CCGGGCGAGGTCTGGACCGAATTAACTCGAGTTAATTCGGTCCAGACCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-1072s21c1
Sequence:GTACCGGGTCCGAGGGTGCTCTTATTTCCTCGAGGAAATAAGAGCACCCTCGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005605.3-880s1c1
Sequence:CCGGGCCCTCTTAAACCAGCAGTTTCTCGAGAAACTGCTGGTTTAAGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005605.3-773s1c1
Sequence:CCGGGCAGGCATCTTACAGACTATTCTCGAGAATAGTCTGTAAGATGCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005605.3-400s1c1
Sequence:CCGGCGGCTTACTTTCAAGGAAGTACTCGAGTACTTCCTTGAAAGTAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005605.3-1240s1c1
Sequence:CCGGCCCAATTACCTAGATGTCTATCTCGAGATAGACATCTAGGTAATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005605.3-1985s1c1
Sequence:CCGGCAGTCTGCATTTATTCTGTAACTCGAGTTACAGAATAAATGCAGACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-1781s21c1
Sequence:CCGGACGCTGGTGGGCCAATGAAATCTCGAGATTTCATTGGCCCACCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-1409s21c1
Sequence:CCGGTGGTAAATGTGCTCAACATATCTCGAGATATGTTGAGCACATTTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005605.3-1880s21c1
Sequence:CCGGCGTGGCTCAGGTGGATCTAAACTCGAGTTTAGATCCACCTGAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005605
VALIDATED
PPP3CC MISSION shRNA shRNA Plasmid DNA
protein phosphatase 3, catalytic subunit, gamma isozyme
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005605.3-1961s21c1
Sequence:GTACCGGCAACCTGGAGGTGCATTTATACTCGAGTATAAATGCACCTCCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-625s21c1
Sequence:CCGGGTTGGAGGATCACCTAGTAACCTCGAGGTTACTAGGTGATCCTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-592s21c1
Sequence:CCGGGGACAATTCTTTGACCTAATGCTCGAGCATTAGGTCAAAGAATTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-1728s21c1
Sequence:CCGGGCGAGGTCTGGACCGAATTAACTCGAGTTAATTCGGTCCAGACCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-1072s21c1
Sequence:GTACCGGGTCCGAGGGTGCTCTTATTTCCTCGAGGAAATAAGAGCACCCTCGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005605.3-880s1c1
Sequence:CCGGGCCCTCTTAAACCAGCAGTTTCTCGAGAAACTGCTGGTTTAAGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005605.3-773s1c1
Sequence:CCGGGCAGGCATCTTACAGACTATTCTCGAGAATAGTCTGTAAGATGCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005605.3-400s1c1
Sequence:CCGGCGGCTTACTTTCAAGGAAGTACTCGAGTACTTCCTTGAAAGTAAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005605.3-1240s1c1
Sequence:CCGGCCCAATTACCTAGATGTCTATCTCGAGATAGACATCTAGGTAATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005605.3-1985s1c1
Sequence:CCGGCAGTCTGCATTTATTCTGTAACTCGAGTTACAGAATAAATGCAGACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-1781s21c1
Sequence:CCGGACGCTGGTGGGCCAATGAAATCTCGAGATTTCATTGGCCCACCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-1409s21c1
Sequence:CCGGTGGTAAATGTGCTCAACATATCTCGAGATATGTTGAGCACATTTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005605.3-1880s21c1
Sequence:CCGGCGTGGCTCAGGTGGATCTAAACTCGAGTTTAGATCCACCTGAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005605
VALIDATED
PPP3CC MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 3, catalytic subunit, gamma isozyme
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005605.3-1961s21c1
Sequence:GTACCGGCAACCTGGAGGTGCATTTATACTCGAGTATAAATGCACCTCCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-625s21c1
Sequence:CCGGGTTGGAGGATCACCTAGTAACCTCGAGGTTACTAGGTGATCCTCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-592s21c1
Sequence:CCGGGGACAATTCTTTGACCTAATGCTCGAGCATTAGGTCAAAGAATTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-1728s21c1
Sequence:CCGGGCGAGGTCTGGACCGAATTAACTCGAGTTAATTCGGTCCAGACCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-1072s21c1
Sequence:GTACCGGGTCCGAGGGTGCTCTTATTTCCTCGAGGAAATAAGAGCACCCTCGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005605.3-880s1c1
Sequence:CCGGGCCCTCTTAAACCAGCAGTTTCTCGAGAAACTGCTGGTTTAAGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005605.3-773s1c1
Sequence:CCGGGCAGGCATCTTACAGACTATTCTCGAGAATAGTCTGTAAGATGCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005605.3-400s1c1
Sequence:CCGGCGGCTTACTTTCAAGGAAGTACTCGAGTACTTCCTTGAAAGTAAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005605.3-1240s1c1
Sequence:CCGGCCCAATTACCTAGATGTCTATCTCGAGATAGACATCTAGGTAATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005605.3-1985s1c1
Sequence:CCGGCAGTCTGCATTTATTCTGTAACTCGAGTTACAGAATAAATGCAGACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-1781s21c1
Sequence:CCGGACGCTGGTGGGCCAATGAAATCTCGAGATTTCATTGGCCCACCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005605.3-1409s21c1
Sequence:CCGGTGGTAAATGTGCTCAACATATCTCGAGATATGTTGAGCACATTTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005605.3-1880s21c1
Sequence:CCGGCGTGGCTCAGGTGGATCTAAACTCGAGTTTAGATCCACCTGAGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008915
PPP3CC MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 3, catalytic subunit, gamma isozyme
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008915.1-594s1c1
Sequence:CCGGGCTGTATCTATGGAGCTTAAACTCGAGTTTAAGCTCCATAGATACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008915.1-1796s1c1
Sequence:CCGGCCTATGAGCAAATCACATTTACTCGAGTAAATGTGATTTGCTCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008915.1-1615s1c1
Sequence:CCGGCGAGGTCTAGACCGAATTAATCTCGAGATTAATTCGGTCTAGACCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008915.1-289s1c1
Sequence:CCGGCGGCTAACTTTGAAGGAAGTTCTCGAGAACTTCCTTCAAAGTTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008915.1-1322s1c1
Sequence:CCGGCGGATGAAGAAATGAACGTAACTCGAGTTACGTTCATTTCTTCATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008915
PPP3CC MISSION shRNA shRNA Plasmid DNA
protein phosphatase 3, catalytic subunit, gamma isozyme
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008915.1-594s1c1
Sequence:CCGGGCTGTATCTATGGAGCTTAAACTCGAGTTTAAGCTCCATAGATACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008915.1-1796s1c1
Sequence:CCGGCCTATGAGCAAATCACATTTACTCGAGTAAATGTGATTTGCTCATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008915.1-1615s1c1
Sequence:CCGGCGAGGTCTAGACCGAATTAATCTCGAGATTAATTCGGTCTAGACCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008915.1-289s1c1
Sequence:CCGGCGGCTAACTTTGAAGGAAGTTCTCGAGAACTTCCTTCAAAGTTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008915.1-1322s1c1
Sequence:CCGGCGGATGAAGAAATGAACGTAACTCGAGTTACGTTCATTTCTTCATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008915
PPP3CC MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 3, catalytic subunit, gamma isozyme
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008915.1-594s1c1
Sequence:CCGGGCTGTATCTATGGAGCTTAAACTCGAGTTTAAGCTCCATAGATACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008915.1-1796s1c1
Sequence:CCGGCCTATGAGCAAATCACATTTACTCGAGTAAATGTGATTTGCTCATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008915.1-1615s1c1
Sequence:CCGGCGAGGTCTAGACCGAATTAATCTCGAGATTAATTCGGTCTAGACCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008915.1-289s1c1
Sequence:CCGGCGGCTAACTTTGAAGGAAGTTCTCGAGAACTTCCTTCAAAGTTAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008915.1-1322s1c1
Sequence:CCGGCGGATGAAGAAATGAACGTAACTCGAGTTACGTTCATTTCTTCATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)