EMAIL THIS PAGE TO A FRIEND

PPP3R1

protein phosphatase 3, regulatory subunit B, alpha

209 Gene Product Result for
Synonyms: CALNB1 CNB CNB1
Gene ID:
Mouse(19058) protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type I)
Rat(29748) protein phosphatase 3, regulatory subunit B, alpha
chicken(378804) protein phosphatase 3, regulatory subunit B, alpha
domestic cat(101090344) protein phosphatase 3, regulatory subunit B, alpha
dog(612559) protein phosphatase 3, regulatory subunit B, alpha
naked mole-rat(101706255) protein phosphatase 3, regulatory subunit B, alpha
domestic guinea pig(100721882) protein phosphatase 3, regulatory subunit B, alpha
cow(282321) protein phosphatase 3, regulatory subunit B, alpha
sheep(101110746) protein phosphatase 3, regulatory subunit B, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C3662 Cyclosporin A from Tolypocladium inflatum, ≥95% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000945 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000945 Rosetta Predictions human pricing
NM_017309 Rosetta Predictions rat pricing
NM_024459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065705 predicted 971
2 SASI_Hs01_00065706 predicted 670
3 SASI_Hs01_00065707 predicted 556
4 SASI_Hs01_00065708 predicted 910
5 SASI_Hs01_00065709 predicted 527
6 SASI_Hs01_00065710 predicted 628
7 SASI_Hs01_00065711 predicted 763
8 SASI_Hs01_00065712 predicted 580
9 SASI_Hs01_00065713 predicted 889
10 SASI_Hs01_00065714 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105943 predicted 438
2 SASI_Rn01_00105944 predicted 577
3 SASI_Rn01_00105945 predicted 359
4 SASI_Rn01_00105946 predicted 587
5 SASI_Rn01_00105947 predicted 409
6 SASI_Rn01_00105948 predicted 396
7 SASI_Rn01_00105949 predicted 369
8 SASI_Rn01_00105950 predicted 726
9 SASI_Rn01_00105951 predicted 438
10 SASI_Rn02_00261756 predicted 277
11 SASI_Rn01_00105952 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125409 predicted 547
2 SASI_Mm01_00125410 predicted 556
3 SASI_Mm01_00125412 predicted 608
4 SASI_Mm01_00125413 predicted 492
5 SASI_Mm01_00125414 predicted 340
6 SASI_Mm01_00125415 predicted 379
7 SASI_Mm01_00125417 predicted 319
8 SASI_Mm01_00125418 predicted 489
9 SASI_Mm02_00327814 predicted 364
10 SASI_Mm02_00327815 predicted 376
11 SASI_Mm01_00125411 predicted 603
12 SASI_Mm01_00125416 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024459
VALIDATED
PPP3R1 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 3, regulatory subunit B, alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024459.2-600s21c1
Sequence:CCGGGTGGGCAACAATCTGAAAGATCTCGAGATCTTTCAGATTGTTGCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024459.1-571s1c1
Sequence:CCGGCCACTCATGAAGGACAGTTTACTCGAGTAAACTGTCCTTCATGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024459.1-278s1c1
Sequence:CCGGGTGGACTTCAAAGAATTCATTCTCGAGAATGAATTCTTTGAAGTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024459.1-428s1c1
Sequence:CCGGGTGGGCAACAATCTGAAAGATCTCGAGATCTTTCAGATTGTTGCCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024459.1-227s1c1
Sequence:CCGGCCTTTAGTACAGCGGGTAATACTCGAGTATTACCCGCTGTACTAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024459.1-359s1c1
Sequence:CCGGCGTATCTATGACATGGATAAACTCGAGTTTATCCATGTCATAGATACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024459.2-399s21c1
Sequence:CCGGCCTTTAGTACAGCGGGTAATACTCGAGTATTACCCGCTGTACTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024459.2-531s21c1
Sequence:CCGGCGTATCTATGACATGGATAAACTCGAGTTTATCCATGTCATAGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024459.2-1240s21c1
Sequence:CCGGTACAATTTGCGCCAGGTATTACTCGAGTAATACCTGGCGCAAATTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024459.2-450s21c1
Sequence:CCGGGTGGACTTCAAAGAATTCATTCTCGAGAATGAATTCTTTGAAGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024459
VALIDATED
PPP3R1 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 3, regulatory subunit B, alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024459.2-600s21c1
Sequence:CCGGGTGGGCAACAATCTGAAAGATCTCGAGATCTTTCAGATTGTTGCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024459.1-571s1c1
Sequence:CCGGCCACTCATGAAGGACAGTTTACTCGAGTAAACTGTCCTTCATGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024459.1-278s1c1
Sequence:CCGGGTGGACTTCAAAGAATTCATTCTCGAGAATGAATTCTTTGAAGTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024459.1-428s1c1
Sequence:CCGGGTGGGCAACAATCTGAAAGATCTCGAGATCTTTCAGATTGTTGCCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024459.1-227s1c1
Sequence:CCGGCCTTTAGTACAGCGGGTAATACTCGAGTATTACCCGCTGTACTAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024459.1-359s1c1
Sequence:CCGGCGTATCTATGACATGGATAAACTCGAGTTTATCCATGTCATAGATACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024459.2-399s21c1
Sequence:CCGGCCTTTAGTACAGCGGGTAATACTCGAGTATTACCCGCTGTACTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024459.2-531s21c1
Sequence:CCGGCGTATCTATGACATGGATAAACTCGAGTTTATCCATGTCATAGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024459.2-1240s21c1
Sequence:CCGGTACAATTTGCGCCAGGTATTACTCGAGTAATACCTGGCGCAAATTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024459.2-450s21c1
Sequence:CCGGGTGGACTTCAAAGAATTCATTCTCGAGAATGAATTCTTTGAAGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024459
VALIDATED
PPP3R1 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 3, regulatory subunit B, alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024459.2-600s21c1
Sequence:CCGGGTGGGCAACAATCTGAAAGATCTCGAGATCTTTCAGATTGTTGCCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024459.1-571s1c1
Sequence:CCGGCCACTCATGAAGGACAGTTTACTCGAGTAAACTGTCCTTCATGAGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024459.1-278s1c1
Sequence:CCGGGTGGACTTCAAAGAATTCATTCTCGAGAATGAATTCTTTGAAGTCCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024459.1-428s1c1
Sequence:CCGGGTGGGCAACAATCTGAAAGATCTCGAGATCTTTCAGATTGTTGCCCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024459.1-227s1c1
Sequence:CCGGCCTTTAGTACAGCGGGTAATACTCGAGTATTACCCGCTGTACTAAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024459.1-359s1c1
Sequence:CCGGCGTATCTATGACATGGATAAACTCGAGTTTATCCATGTCATAGATACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024459.2-399s21c1
Sequence:CCGGCCTTTAGTACAGCGGGTAATACTCGAGTATTACCCGCTGTACTAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024459.2-531s21c1
Sequence:CCGGCGTATCTATGACATGGATAAACTCGAGTTTATCCATGTCATAGATACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024459.2-1240s21c1
Sequence:CCGGTACAATTTGCGCCAGGTATTACTCGAGTAATACCTGGCGCAAATTGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024459.2-450s21c1
Sequence:CCGGGTGGACTTCAAAGAATTCATTCTCGAGAATGAATTCTTTGAAGTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000945
VALIDATED
PPP3R1 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 3, regulatory subunit B, alpha
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000945.x-640s1c1
Sequence:CCGGCAAAGGAGATAAGGAGCAGAACTCGAGTTCTGCTCCTTATCTCCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000945.x-664s1c1
Sequence:CCGGGAGGTTTGCTTTCCGTATCTACTCGAGTAGATACGGAAAGCAAACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000945.x-764s1c1
Sequence:CCGGGATACACAGTTACAGCAAATTCTCGAGAATTTGCTGTAACTGTGTATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000945.x-2939s1c1
Sequence:CCGGCGTCATGTTGTGGGATCTTTACTCGAGTAAAGATCCCACAACATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-467s21c1
Sequence:GTACCGGGAGATTTAAGAAGCTTGATTTCTCGAGAAATCAAGCTTCTTAAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-2944s21c1
Sequence:CCGGCGTCATGTTGTGGGATCTTTACTCGAGTAAAGATCCCACAACATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000945.x-807s1c1
Sequence:CCGGCAGATAAGGATGGAGATGGAACTCGAGTTCCATCTCCATCCTTATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000945.3-668s21c1
Sequence:CCGGGAGGTTTGCTTTCCGTATCTACTCGAGTAGATACGGAAAGCAAACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-768s21c1
Sequence:CCGGGATACACAGTTACAGCAAATTCTCGAGAATTTGCTGTAACTGTGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-549s21c1
Sequence:CCGGCCTTTAGTACAGCGAGTAATACTCGAGTATTACTCGCTGTACTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-892s21c1
Sequence:CCGGTGGTAGATGTGTGACTCTTATCTCGAGATAAGAGTCACACATCTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000945
VALIDATED
PPP3R1 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 3, regulatory subunit B, alpha
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000945.x-640s1c1
Sequence:CCGGCAAAGGAGATAAGGAGCAGAACTCGAGTTCTGCTCCTTATCTCCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000945.x-664s1c1
Sequence:CCGGGAGGTTTGCTTTCCGTATCTACTCGAGTAGATACGGAAAGCAAACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000945.x-764s1c1
Sequence:CCGGGATACACAGTTACAGCAAATTCTCGAGAATTTGCTGTAACTGTGTATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000945.x-2939s1c1
Sequence:CCGGCGTCATGTTGTGGGATCTTTACTCGAGTAAAGATCCCACAACATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-467s21c1
Sequence:GTACCGGGAGATTTAAGAAGCTTGATTTCTCGAGAAATCAAGCTTCTTAAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-2944s21c1
Sequence:CCGGCGTCATGTTGTGGGATCTTTACTCGAGTAAAGATCCCACAACATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000945.x-807s1c1
Sequence:CCGGCAGATAAGGATGGAGATGGAACTCGAGTTCCATCTCCATCCTTATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000945.3-668s21c1
Sequence:CCGGGAGGTTTGCTTTCCGTATCTACTCGAGTAGATACGGAAAGCAAACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-768s21c1
Sequence:CCGGGATACACAGTTACAGCAAATTCTCGAGAATTTGCTGTAACTGTGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-549s21c1
Sequence:CCGGCCTTTAGTACAGCGAGTAATACTCGAGTATTACTCGCTGTACTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-892s21c1
Sequence:CCGGTGGTAGATGTGTGACTCTTATCTCGAGATAAGAGTCACACATCTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000945
VALIDATED
PPP3R1 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 3, regulatory subunit B, alpha
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000945.x-640s1c1
Sequence:CCGGCAAAGGAGATAAGGAGCAGAACTCGAGTTCTGCTCCTTATCTCCTTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000945.x-664s1c1
Sequence:CCGGGAGGTTTGCTTTCCGTATCTACTCGAGTAGATACGGAAAGCAAACCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000945.x-764s1c1
Sequence:CCGGGATACACAGTTACAGCAAATTCTCGAGAATTTGCTGTAACTGTGTATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000945.x-2939s1c1
Sequence:CCGGCGTCATGTTGTGGGATCTTTACTCGAGTAAAGATCCCACAACATGACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-467s21c1
Sequence:GTACCGGGAGATTTAAGAAGCTTGATTTCTCGAGAAATCAAGCTTCTTAAATCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-2944s21c1
Sequence:CCGGCGTCATGTTGTGGGATCTTTACTCGAGTAAAGATCCCACAACATGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000945.x-807s1c1
Sequence:CCGGCAGATAAGGATGGAGATGGAACTCGAGTTCCATCTCCATCCTTATCTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000945.3-668s21c1
Sequence:CCGGGAGGTTTGCTTTCCGTATCTACTCGAGTAGATACGGAAAGCAAACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-768s21c1
Sequence:CCGGGATACACAGTTACAGCAAATTCTCGAGAATTTGCTGTAACTGTGTATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-549s21c1
Sequence:CCGGCCTTTAGTACAGCGAGTAATACTCGAGTATTACTCGCTGTACTAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000945.3-892s21c1
Sequence:CCGGTGGTAGATGTGTGACTCTTATCTCGAGATAAGAGTCACACATCTACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)