EMAIL THIS PAGE TO A FRIEND

PPP3R2

protein phosphatase 3, regulatory subunit B, beta

64 Gene Product Result for
Synonyms: PPP3RL
UniProtKB ID: Q96LZ3, Q5VTR4, Q7Z4V8, Q8WYJ4
Gene ID:
Mouse(19059) protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type II)
Rat(29749) protein phosphatase 3, regulatory subunit B, beta
dog(610453) protein phosphatase 3, regulatory subunit B, beta
domestic cat(101097765) protein phosphatase 3, regulatory subunit B, beta
cow(617585) protein phosphatase 3, regulatory subunit B, beta
sheep(101120802) protein phosphatase 3, regulatory subunit B, beta
naked mole-rat(101710684) protein phosphatase 3, regulatory subunit B, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C3662 Cyclosporin A from Tolypocladium inflatum, ≥95% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_147180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007391 MISSION® esiRNA esiRNA targeting human PPP3R2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147180 Rosetta Predictions human pricing
NM_021701 Rosetta Predictions rat pricing
NM_001004025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223643 predicted 1062
2 SASI_Hs01_00223645 predicted 875
3 SASI_Hs01_00223647 predicted 1032
4 SASI_Hs01_00223648 predicted 1002
5 SASI_Hs01_00223649 predicted 247
6 SASI_Hs01_00223650 predicted 987
7 SASI_Hs01_00223651 predicted 672
8 SASI_Hs01_00223652 predicted 363
9 SASI_Hs02_00365519 predicted 660
10 SASI_Hs02_00365520 predicted 350
11 SASI_Hs01_00223644 predicted 744
12 SASI_Hs01_00223646 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043574 predicted 348
2 SASI_Rn01_00043575 predicted 318
3 SASI_Rn02_00262747 predicted 491
4 SASI_Rn01_00043576 predicted 478
5 SASI_Rn01_00043577 predicted 504
6 SASI_Rn01_00043578 predicted 515
7 SASI_Rn01_00043579 predicted 427
8 SASI_Rn01_00043581 predicted 309
9 SASI_Rn02_00262748 predicted 276
10 SASI_Rn01_00043582 predicted 489
11 SASI_Rn01_00043580 predicted 456
12 SASI_Rn01_00043583 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286437 predicted 838
2 SASI_Mm01_00105567 predicted 872
3 SASI_Mm01_00105568 predicted 808
4 SASI_Mm01_00105569 predicted 802
5 SASI_Mm01_00105570 predicted 515
6 SASI_Mm01_00105571 predicted 631
7 SASI_Mm01_00105572 predicted 433
8 SASI_Mm01_00105573 predicted 464
9 SASI_Mm01_00105574 predicted 197
10 SASI_Mm02_00286438 predicted 530
11 SASI_Mm01_00105565 predicted 845
12 SASI_Mm01_00105566 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147180
PPP3R2 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 3, regulatory subunit B, beta
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-279s21c1
Sequence:CCGGGATGGAGAAGTGGACTTCAAGCTCGAGCTTGAAGTCCACTTCTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147180.2-736s21c1
Sequence:CCGGTCACCAACTCAGTGCTATTAACTCGAGTTAATAGCACTGAGTTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-572s21c1
Sequence:CCGGGAAGCTGGTCCTCATCGTATGCTCGAGCATACGATGAGGACCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-505s21c1
Sequence:CCGGAGGATGGCGATGGGAAGATATCTCGAGATATCTTCCCATCGCCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-164s21c1
Sequence:CCGGGAAGTTGGACTTGGACAAATCCTCGAGGATTTGTCCAAGTCCAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147180.2-3133s1c1
Sequence:CCGGGCTGGAATTTACAAGCTAATTCTCGAGAATTAGCTTGTAAATTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147180.2-155s1c1
Sequence:CCGGGAGGTTTAAGAAGTTGGACTTCTCGAGAAGTCCAACTTCTTAAACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147180.2-425s1c1
Sequence:CCGGGCTGAAGATGATGGTGGGCAACTCGAGTTGCCCACCATCATCTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-191s21c1
Sequence:CCGGTCTGAGCGTGGAGGAGTTCATCTCGAGATGAACTCCTCCACGCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147180.2-1041s21c1
Sequence:CCGGTGTAGCAACAGGGACAAATATCTCGAGATATTTGTCCCTGTTGCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147180.2-367s1c1
Sequence:CCGGTCAGCATTTACGACATGGATACTCGAGTATCCATGTCGTAAATGCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147180.2-119s1c1
Sequence:CCGGCCACTTTGACAATGATGAAATCTCGAGATTTCATCATTGTCAAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-119s21c1
Sequence:CCGGCCACTTTGACAATGATGAAATCTCGAGATTTCATCATTGTCAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147180
PPP3R2 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 3, regulatory subunit B, beta
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-279s21c1
Sequence:CCGGGATGGAGAAGTGGACTTCAAGCTCGAGCTTGAAGTCCACTTCTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147180.2-736s21c1
Sequence:CCGGTCACCAACTCAGTGCTATTAACTCGAGTTAATAGCACTGAGTTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-572s21c1
Sequence:CCGGGAAGCTGGTCCTCATCGTATGCTCGAGCATACGATGAGGACCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-505s21c1
Sequence:CCGGAGGATGGCGATGGGAAGATATCTCGAGATATCTTCCCATCGCCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-164s21c1
Sequence:CCGGGAAGTTGGACTTGGACAAATCCTCGAGGATTTGTCCAAGTCCAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147180.2-3133s1c1
Sequence:CCGGGCTGGAATTTACAAGCTAATTCTCGAGAATTAGCTTGTAAATTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147180.2-155s1c1
Sequence:CCGGGAGGTTTAAGAAGTTGGACTTCTCGAGAAGTCCAACTTCTTAAACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147180.2-425s1c1
Sequence:CCGGGCTGAAGATGATGGTGGGCAACTCGAGTTGCCCACCATCATCTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-191s21c1
Sequence:CCGGTCTGAGCGTGGAGGAGTTCATCTCGAGATGAACTCCTCCACGCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147180.2-1041s21c1
Sequence:CCGGTGTAGCAACAGGGACAAATATCTCGAGATATTTGTCCCTGTTGCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147180.2-367s1c1
Sequence:CCGGTCAGCATTTACGACATGGATACTCGAGTATCCATGTCGTAAATGCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147180.2-119s1c1
Sequence:CCGGCCACTTTGACAATGATGAAATCTCGAGATTTCATCATTGTCAAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-119s21c1
Sequence:CCGGCCACTTTGACAATGATGAAATCTCGAGATTTCATCATTGTCAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147180
PPP3R2 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 3, regulatory subunit B, beta
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-279s21c1
Sequence:CCGGGATGGAGAAGTGGACTTCAAGCTCGAGCTTGAAGTCCACTTCTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147180.2-736s21c1
Sequence:CCGGTCACCAACTCAGTGCTATTAACTCGAGTTAATAGCACTGAGTTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-572s21c1
Sequence:CCGGGAAGCTGGTCCTCATCGTATGCTCGAGCATACGATGAGGACCAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-505s21c1
Sequence:CCGGAGGATGGCGATGGGAAGATATCTCGAGATATCTTCCCATCGCCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-164s21c1
Sequence:CCGGGAAGTTGGACTTGGACAAATCCTCGAGGATTTGTCCAAGTCCAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147180.2-3133s1c1
Sequence:CCGGGCTGGAATTTACAAGCTAATTCTCGAGAATTAGCTTGTAAATTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147180.2-155s1c1
Sequence:CCGGGAGGTTTAAGAAGTTGGACTTCTCGAGAAGTCCAACTTCTTAAACCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147180.2-425s1c1
Sequence:CCGGGCTGAAGATGATGGTGGGCAACTCGAGTTGCCCACCATCATCTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-191s21c1
Sequence:CCGGTCTGAGCGTGGAGGAGTTCATCTCGAGATGAACTCCTCCACGCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147180.2-1041s21c1
Sequence:CCGGTGTAGCAACAGGGACAAATATCTCGAGATATTTGTCCCTGTTGCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147180.2-367s1c1
Sequence:CCGGTCAGCATTTACGACATGGATACTCGAGTATCCATGTCGTAAATGCTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147180.2-119s1c1
Sequence:CCGGCCACTTTGACAATGATGAAATCTCGAGATTTCATCATTGTCAAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147180.2-119s21c1
Sequence:CCGGCCACTTTGACAATGATGAAATCTCGAGATTTCATCATTGTCAAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004025
VALIDATED
PPP3R2 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 3, regulatory subunit B, beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004025.4-90s21c1
Sequence:CCGGGAGATAAGAAGGCTGGGTAAACTCGAGTTTACCCAGCCTTCTTATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004025.4-548s21c1
Sequence:CCGGACACGGTCAAGAAGACTTAAACTCGAGTTTAAGTCTTCTTGACCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004025.4-380s21c1
Sequence:CCGGGCTTAAGATGATGGTGGGAAACTCGAGTTTCCCACCATCATCTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004025.4-805s21c1
Sequence:CCGGCCTGAGTATGTTTGAGGGATACTCGAGTATCCCTCAAACATACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004025.4-521s21c1
Sequence:CCGGCCACAAGAAATTGGTCGTGTTCTCGAGAACACGACCAATTTCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004025.1-807s1c1
Sequence:CCGGCCTGAGTATGTTTGAGGGATACTCGAGTATCCCTCAAACATACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004025.1-475s1c1
Sequence:CCGGCCGGATATCCTTTGAAGAGTTCTCGAGAACTCTTCAAAGGATATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004025.1-382s1c1
Sequence:CCGGGCTTAAGATGATGGTGGGAAACTCGAGTTTCCCACCATCATCTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004025.1-319s1c1
Sequence:CCGGCGCCTTCAGAATCTACGACATCTCGAGATGTCGTAGATTCTGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004025.1-523s1c1
Sequence:CCGGCCACAAGAAATTGGTCGTGTTCTCGAGAACACGACCAATTTCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004025
VALIDATED
PPP3R2 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 3, regulatory subunit B, beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004025.4-90s21c1
Sequence:CCGGGAGATAAGAAGGCTGGGTAAACTCGAGTTTACCCAGCCTTCTTATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004025.4-548s21c1
Sequence:CCGGACACGGTCAAGAAGACTTAAACTCGAGTTTAAGTCTTCTTGACCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004025.4-380s21c1
Sequence:CCGGGCTTAAGATGATGGTGGGAAACTCGAGTTTCCCACCATCATCTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004025.4-805s21c1
Sequence:CCGGCCTGAGTATGTTTGAGGGATACTCGAGTATCCCTCAAACATACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004025.4-521s21c1
Sequence:CCGGCCACAAGAAATTGGTCGTGTTCTCGAGAACACGACCAATTTCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004025.1-807s1c1
Sequence:CCGGCCTGAGTATGTTTGAGGGATACTCGAGTATCCCTCAAACATACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004025.1-475s1c1
Sequence:CCGGCCGGATATCCTTTGAAGAGTTCTCGAGAACTCTTCAAAGGATATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004025.1-382s1c1
Sequence:CCGGGCTTAAGATGATGGTGGGAAACTCGAGTTTCCCACCATCATCTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004025.1-319s1c1
Sequence:CCGGCGCCTTCAGAATCTACGACATCTCGAGATGTCGTAGATTCTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004025.1-523s1c1
Sequence:CCGGCCACAAGAAATTGGTCGTGTTCTCGAGAACACGACCAATTTCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004025
VALIDATED
PPP3R2 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 3, regulatory subunit B, beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004025.4-90s21c1
Sequence:CCGGGAGATAAGAAGGCTGGGTAAACTCGAGTTTACCCAGCCTTCTTATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004025.4-548s21c1
Sequence:CCGGACACGGTCAAGAAGACTTAAACTCGAGTTTAAGTCTTCTTGACCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004025.4-380s21c1
Sequence:CCGGGCTTAAGATGATGGTGGGAAACTCGAGTTTCCCACCATCATCTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004025.4-805s21c1
Sequence:CCGGCCTGAGTATGTTTGAGGGATACTCGAGTATCCCTCAAACATACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004025.4-521s21c1
Sequence:CCGGCCACAAGAAATTGGTCGTGTTCTCGAGAACACGACCAATTTCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004025.1-807s1c1
Sequence:CCGGCCTGAGTATGTTTGAGGGATACTCGAGTATCCCTCAAACATACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004025.1-475s1c1
Sequence:CCGGCCGGATATCCTTTGAAGAGTTCTCGAGAACTCTTCAAAGGATATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004025.1-382s1c1
Sequence:CCGGGCTTAAGATGATGGTGGGAAACTCGAGTTTCCCACCATCATCTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004025.1-319s1c1
Sequence:CCGGCGCCTTCAGAATCTACGACATCTCGAGATGTCGTAGATTCTGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004025.1-523s1c1
Sequence:CCGGCCACAAGAAATTGGTCGTGTTCTCGAGAACACGACCAATTTCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)