EMAIL THIS PAGE TO A FRIEND

PPP4C

protein phosphatase 4, catalytic subunit

112 Gene Product Result for
Synonyms: PP4 PP4C PPH3 PPP4 PPX
UniProtKB ID: P60510, P33172
Gene ID:
Mouse(56420) protein phosphatase 4, catalytic subunit
Rat(171366) protein phosphatase 4, catalytic subunit
naked mole-rat(101701412) protein phosphatase 4, catalytic subunit
Domestic Rabbit(100009163) protein phosphatase 4, catalytic subunit
domestic guinea pig(100730126) protein phosphatase 4, catalytic subunit
cow(540398) protein phosphatase 4, catalytic subunit
sheep(101115751) protein phosphatase 4, catalytic subunit
Horse(100064118) protein phosphatase 4, catalytic subunit
dog(489947) protein phosphatase 4, catalytic subunit
domestic cat(101101530) protein phosphatase 4, catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002720 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002720 Rosetta Predictions human pricing
NM_134359 Rosetta Predictions rat pricing
NM_019674 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192608 predicted 406
2 SASI_Hs01_00192609 predicted 527
3 SASI_Hs01_00192610 predicted 243
4 SASI_Hs01_00192611 predicted 556
5 SASI_Hs01_00192612 predicted 880
6 SASI_Hs01_00192613 predicted 806
7 SASI_Hs01_00192614 predicted 495
8 SASI_Hs01_00192615 predicted 646
9 SASI_Hs01_00192616 predicted 816
10 SASI_Hs02_00334316 predicted 266
11 SASI_Hs01_00192617 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097531 predicted 270
2 SASI_Rn01_00097532 predicted 907
3 SASI_Rn01_00097533 predicted 570
4 SASI_Rn01_00097534 predicted 586
5 SASI_Rn01_00097535 predicted 979
6 SASI_Rn01_00097536 predicted 606
7 SASI_Rn01_00097537 predicted 436
8 SASI_Rn01_00097538 predicted 511
9 SASI_Rn01_00097539 predicted 551
10 SASI_Rn01_00097540 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172154 predicted 643
2 SASI_Mm02_00324747 predicted 509
3 SASI_Mm01_00172157 predicted 523
4 SASI_Mm02_00324748 predicted 498
5 SASI_Mm01_00172159 predicted 906
6 SASI_Mm01_00172160 predicted 889
7 SASI_Mm02_00324749 predicted 534
8 SASI_Mm01_00172161 predicted 841
9 SASI_Mm02_00324750 predicted 367
10 SASI_Mm02_00324751 predicted 841
11 SASI_Mm01_00172152 predicted 491
12 SASI_Mm01_00172153 predicted 796
13 SASI_Mm01_00172155 predicted 326
14 SASI_Mm01_00172156 predicted 775
15 SASI_Mm01_00172158 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019674
VALIDATED
PPP4C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 4, catalytic subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019674.3-646s21c1
Sequence:CCGGCGGACAATTGACCGAAAGCAACTCGAGTTGCTTTCGGTCAATTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019674.3-823s21c1
Sequence:CCGGGCCCACCAATTAGTGATGGAACTCGAGTTCCATCACTAATTGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-1194s1c1
Sequence:CCGGCCCACTTGATCCATGAAGTTTCTCGAGAAACTTCATGGATCAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-646s1c1
Sequence:CCGGCGGACAATTGACCGAAAGCAACTCGAGTTGCTTTCGGTCAATTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-370s1c1
Sequence:CCGGCGTGGTTTCTACAGTGTTGAACTCGAGTTCAACACTGTAGAAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-823s1c1
Sequence:CCGGGCCCACCAATTAGTGATGGAACTCGAGTTCCATCACTAATTGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-367s1c1
Sequence:CCGGGACCGTGGTTTCTACAGTGTTCTCGAGAACACTGTAGAAACCACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019674.3-1194s21c1
Sequence:CCGGCCCACTTGATCCATGAAGTTTCTCGAGAAACTTCATGGATCAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019674.3-367s21c1
Sequence:CCGGGACCGTGGTTTCTACAGTGTTCTCGAGAACACTGTAGAAACCACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019674
VALIDATED
PPP4C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 4, catalytic subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019674.3-646s21c1
Sequence:CCGGCGGACAATTGACCGAAAGCAACTCGAGTTGCTTTCGGTCAATTGTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000325103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019674.3-823s21c1
Sequence:CCGGGCCCACCAATTAGTGATGGAACTCGAGTTCCATCACTAATTGGTGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-1194s1c1
Sequence:CCGGCCCACTTGATCCATGAAGTTTCTCGAGAAACTTCATGGATCAAGTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-646s1c1
Sequence:CCGGCGGACAATTGACCGAAAGCAACTCGAGTTGCTTTCGGTCAATTGTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-370s1c1
Sequence:CCGGCGTGGTTTCTACAGTGTTGAACTCGAGTTCAACACTGTAGAAACCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-823s1c1
Sequence:CCGGGCCCACCAATTAGTGATGGAACTCGAGTTCCATCACTAATTGGTGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-367s1c1
Sequence:CCGGGACCGTGGTTTCTACAGTGTTCTCGAGAACACTGTAGAAACCACGGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000325102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019674.3-1194s21c1
Sequence:CCGGCCCACTTGATCCATGAAGTTTCTCGAGAAACTTCATGGATCAAGTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000325180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019674.3-367s21c1
Sequence:CCGGGACCGTGGTTTCTACAGTGTTCTCGAGAACACTGTAGAAACCACGGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019674
VALIDATED
PPP4C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 4, catalytic subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019674.3-646s21c1
Sequence:CCGGCGGACAATTGACCGAAAGCAACTCGAGTTGCTTTCGGTCAATTGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019674.3-823s21c1
Sequence:CCGGGCCCACCAATTAGTGATGGAACTCGAGTTCCATCACTAATTGGTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-1194s1c1
Sequence:CCGGCCCACTTGATCCATGAAGTTTCTCGAGAAACTTCATGGATCAAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-646s1c1
Sequence:CCGGCGGACAATTGACCGAAAGCAACTCGAGTTGCTTTCGGTCAATTGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-370s1c1
Sequence:CCGGCGTGGTTTCTACAGTGTTGAACTCGAGTTCAACACTGTAGAAACCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-823s1c1
Sequence:CCGGGCCCACCAATTAGTGATGGAACTCGAGTTCCATCACTAATTGGTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019674.2-367s1c1
Sequence:CCGGGACCGTGGTTTCTACAGTGTTCTCGAGAACACTGTAGAAACCACGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019674.3-1194s21c1
Sequence:CCGGCCCACTTGATCCATGAAGTTTCTCGAGAAACTTCATGGATCAAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019674.3-367s21c1
Sequence:CCGGGACCGTGGTTTCTACAGTGTTCTCGAGAACACTGTAGAAACCACGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002720
VALIDATED
PPP4C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 4, catalytic subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002720.x-524s1c1
Sequence:CCGGGCGCTACTGCACTGAGATCTTCTCGAGAAGATCTCAGTGCAGTAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002720.x-1151s1c1
Sequence:CCGGGTGCTTCGAGGGTGAGGACTTCTCGAGAAGTCCTCACCCTCGAAGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002720.x-161s1c1
Sequence:CCGGCATCAAGGAGAGCGAAGTCAACTCGAGTTGACTTCGCTCTCCTTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002720.x-743s1c1
Sequence:CCGGCGGCTACCTATTTGGCAGTGACTCGAGTCACTGCCAAATAGGTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002720.x-468s1c1
Sequence:CCGGCAGGTCTATGGCTTCTACGATCTCGAGATCGTAGAAGCCATAGACCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-624s21c1
Sequence:CCGGCTGGATCAGATTCGGACAATCCTCGAGGATTGTCCGAATCTGATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-468s21c1
Sequence:CCGGCAGGTCTATGGCTTCTACGATCTCGAGATCGTAGAAGCCATAGACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-1228s21c1
Sequence:CCGGACCATGAAGTTTCCAATAATTCTCGAGAATTATTGGAAACTTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-161s21c1
Sequence:CCGGCATCAAGGAGAGCGAAGTCAACTCGAGTTGACTTCGCTCTCCTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-524s21c1
Sequence:CCGGGCGCTACTGCACTGAGATCTTCTCGAGAAGATCTCAGTGCAGTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002720
VALIDATED
PPP4C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 4, catalytic subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002720.x-524s1c1
Sequence:CCGGGCGCTACTGCACTGAGATCTTCTCGAGAAGATCTCAGTGCAGTAGCGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002720.x-1151s1c1
Sequence:CCGGGTGCTTCGAGGGTGAGGACTTCTCGAGAAGTCCTCACCCTCGAAGCACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002720.x-161s1c1
Sequence:CCGGCATCAAGGAGAGCGAAGTCAACTCGAGTTGACTTCGCTCTCCTTGATGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002720.x-743s1c1
Sequence:CCGGCGGCTACCTATTTGGCAGTGACTCGAGTCACTGCCAAATAGGTAGCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002720.x-468s1c1
Sequence:CCGGCAGGTCTATGGCTTCTACGATCTCGAGATCGTAGAAGCCATAGACCTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000272745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-624s21c1
Sequence:CCGGCTGGATCAGATTCGGACAATCCTCGAGGATTGTCCGAATCTGATCCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000272744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-468s21c1
Sequence:CCGGCAGGTCTATGGCTTCTACGATCTCGAGATCGTAGAAGCCATAGACCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000272746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-1228s21c1
Sequence:CCGGACCATGAAGTTTCCAATAATTCTCGAGAATTATTGGAAACTTCATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000272748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-161s21c1
Sequence:CCGGCATCAAGGAGAGCGAAGTCAACTCGAGTTGACTTCGCTCTCCTTGATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000272747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-524s21c1
Sequence:CCGGGCGCTACTGCACTGAGATCTTCTCGAGAAGATCTCAGTGCAGTAGCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002720
VALIDATED
PPP4C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 4, catalytic subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002720.x-524s1c1
Sequence:CCGGGCGCTACTGCACTGAGATCTTCTCGAGAAGATCTCAGTGCAGTAGCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002720.x-1151s1c1
Sequence:CCGGGTGCTTCGAGGGTGAGGACTTCTCGAGAAGTCCTCACCCTCGAAGCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002720.x-161s1c1
Sequence:CCGGCATCAAGGAGAGCGAAGTCAACTCGAGTTGACTTCGCTCTCCTTGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002720.x-743s1c1
Sequence:CCGGCGGCTACCTATTTGGCAGTGACTCGAGTCACTGCCAAATAGGTAGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002720.x-468s1c1
Sequence:CCGGCAGGTCTATGGCTTCTACGATCTCGAGATCGTAGAAGCCATAGACCTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-624s21c1
Sequence:CCGGCTGGATCAGATTCGGACAATCCTCGAGGATTGTCCGAATCTGATCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-468s21c1
Sequence:CCGGCAGGTCTATGGCTTCTACGATCTCGAGATCGTAGAAGCCATAGACCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-1228s21c1
Sequence:CCGGACCATGAAGTTTCCAATAATTCTCGAGAATTATTGGAAACTTCATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-161s21c1
Sequence:CCGGCATCAAGGAGAGCGAAGTCAACTCGAGTTGACTTCGCTCTCCTTGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002720.1-524s21c1
Sequence:CCGGGCGCTACTGCACTGAGATCTTCTCGAGAAGATCTCAGTGCAGTAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)