EMAIL THIS PAGE TO A FRIEND

PPP4R1

protein phosphatase 4, regulatory subunit 1

153 Gene Product Result for
Synonyms: MEG1 PP4(Rmeg) PP4R1
UniProtKB ID: Q8TF05, Q99774, Q9UNQ7
Gene ID:
Human(9989) Summary: This gene encodes one of several alternate regulatory subunits of serine/threonine protein phosphatase 4 (PP4). The protein features multiple HEAT repeats. This protein forms a complex with PP4RC. This complex may have a distinct role from other PP4 complexes, including regulation of HDAC3 (Zhang et al., PMID: 15805470). There is also a transcribed pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(70351) protein phosphatase 4, regulatory subunit 1
Rat(140943) protein phosphatase 4, regulatory subunit 1
Zebrafish(393230) protein phosphatase 4, regulatory subunit 1
dog(480207) protein phosphatase 4, regulatory subunit 1
Horse(100055125) protein phosphatase 4, regulatory subunit 1
domestic cat(101081763) protein phosphatase 4, regulatory subunit 1
chicken(425903) protein phosphatase 4, regulatory subunit 1
cow(510230) protein phosphatase 4, regulatory subunit 1
sheep(101103940) protein phosphatase 4, regulatory subunit 1
domestic guinea pig(100712897) protein phosphatase 4, regulatory subunit 1
Domestic Rabbit(100354033) protein phosphatase 4, regulatory subunit 1
naked mole-rat(101718351) protein phosphatase 4, regulatory subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005134 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042388 Rosetta Predictions human pricing
NM_005134 Rosetta Predictions human pricing
NM_080907 Rosetta Predictions rat pricing
NM_001114131 Rosetta Predictions mouse pricing
NM_146081 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309418 predicted 983
2 SASI_Hs02_00309419 predicted 2138
3 SASI_Hs02_00309420 predicted 2273
4 SASI_Hs02_00309421 predicted 1520
5 SASI_Hs02_00309422 predicted 2856
6 SASI_Hs02_00309423 predicted 2957
7 SASI_Hs02_00309424 predicted 743
8 SASI_Hs02_00309425 predicted 1897
9 SASI_Hs02_00309426 predicted 1211
10 SASI_Hs02_00309427 predicted 2382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118698 predicted 928
2 SASI_Hs02_00339057 predicted 2086
3 SASI_Hs01_00118699 predicted 2222
4 SASI_Hs01_00118700 predicted 1470
5 SASI_Hs02_00339058 predicted 2810
6 SASI_Hs01_00118701 predicted 2911
7 SASI_Hs01_00118703 predicted 694
8 SASI_Hs02_00339059 predicted 1848
9 SASI_Hs01_00118704 predicted 1163
10 SASI_Hs01_00118705 predicted 2334
11 SASI_Hs01_00118696 predicted 1825
12 SASI_Hs01_00118697 predicted 329
13 SASI_Hs01_00118702 predicted 1387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087959 predicted 283
2 SASI_Rn01_00087960 predicted 2724
3 SASI_Rn01_00087962 predicted 1685
4 SASI_Rn01_00087963 predicted 1041
5 SASI_Rn01_00087964 predicted 2356
6 SASI_Rn01_00087965 predicted 930
7 SASI_Rn01_00087966 predicted 755
8 SASI_Rn02_00267364 predicted 2705
9 SASI_Rn01_00087967 predicted 1625
10 SASI_Rn02_00267365 predicted 2823
11 SASI_Rn01_00087958 predicted 340
12 SASI_Rn01_00087961 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308439 predicted 2065
2 SASI_Mm02_00308440 predicted 2810
3 SASI_Mm02_00308441 predicted 394
4 SASI_Mm02_00308442 predicted 1048
5 SASI_Mm02_00308443 predicted 754
6 SASI_Mm02_00308444 predicted 423
7 SASI_Mm02_00308445 predicted 1898
8 SASI_Mm02_00308446 predicted 2349
9 SASI_Mm02_00308447 predicted 2777
10 SASI_Mm02_00308448 predicted 2302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041826 predicted 2114
2 SASI_Mm01_00041828 predicted 2862
3 SASI_Mm02_00341714 predicted 452
4 SASI_Mm02_00341715 predicted 1101
5 SASI_Mm02_00341716 predicted 807
6 SASI_Mm02_00341717 predicted 471
7 SASI_Mm01_00041833 predicted 1941
8 SASI_Mm01_00041834 predicted 2397
9 SASI_Mm01_00041835 predicted 2820
10 SASI_Mm01_00041830 predicted 2354
11 SASI_Mm01_00041827 predicted 722
12 SASI_Mm01_00041829 predicted 335
13 SASI_Mm01_00041831 predicted 902
14 SASI_Mm01_00041832 predicted 1518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146081
VALIDATED
PPP4R1 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 4, regulatory subunit 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146081.2-1801s21c1
Sequence:CCGGCGACACTTGTGTGCCTTTGATCTCGAGATCAAAGGCACACAAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146081.2-2726s21c1
Sequence:CCGGCCCAATGTTAGAGTGCTGCTTCTCGAGAAGCAGCACTCTAACATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146081.2-252s21c1
Sequence:CCGGCTGCAAGTGAGAACGTATTTACTCGAGTAAATACGTTCTCACTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146081.2-3134s21c1
Sequence:CCGGAGTAAATCTCAGAGGATTATACTCGAGTATAATCCTCTGAGATTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146081.1-1699s1c1
Sequence:CCGGCCCAATGTTAGAGTGCTGCTTCTCGAGAAGCAGCACTCTAACATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146081.1-761s1c1
Sequence:CCGGGTAACATAAGTCACGACACTTCTCGAGAAGTGTCGTGACTTATGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146081.1-1317s1c1
Sequence:CCGGCAACAGTAGAAATTGGCGCTTCTCGAGAAGCGCCAATTTCTACTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146081.1-774s1c1
Sequence:CCGGCGACACTTGTGTGCCTTTGATCTCGAGATCAAAGGCACACAAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146081.1-1871s1c1
Sequence:CCGGCCAAACTCTCTGAAGATGCAACTCGAGTTGCATCTTCAGAGAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146081.2-2344s21c1
Sequence:CCGGCAACAGTAGAAATTGGCGCTTCTCGAGAAGCGCCAATTTCTACTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146081
VALIDATED
PPP4R1 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 4, regulatory subunit 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146081.2-1801s21c1
Sequence:CCGGCGACACTTGTGTGCCTTTGATCTCGAGATCAAAGGCACACAAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146081.2-2726s21c1
Sequence:CCGGCCCAATGTTAGAGTGCTGCTTCTCGAGAAGCAGCACTCTAACATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146081.2-252s21c1
Sequence:CCGGCTGCAAGTGAGAACGTATTTACTCGAGTAAATACGTTCTCACTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146081.2-3134s21c1
Sequence:CCGGAGTAAATCTCAGAGGATTATACTCGAGTATAATCCTCTGAGATTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146081.1-1699s1c1
Sequence:CCGGCCCAATGTTAGAGTGCTGCTTCTCGAGAAGCAGCACTCTAACATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146081.1-761s1c1
Sequence:CCGGGTAACATAAGTCACGACACTTCTCGAGAAGTGTCGTGACTTATGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146081.1-1317s1c1
Sequence:CCGGCAACAGTAGAAATTGGCGCTTCTCGAGAAGCGCCAATTTCTACTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146081.1-774s1c1
Sequence:CCGGCGACACTTGTGTGCCTTTGATCTCGAGATCAAAGGCACACAAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146081.1-1871s1c1
Sequence:CCGGCCAAACTCTCTGAAGATGCAACTCGAGTTGCATCTTCAGAGAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146081.2-2344s21c1
Sequence:CCGGCAACAGTAGAAATTGGCGCTTCTCGAGAAGCGCCAATTTCTACTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146081
VALIDATED
PPP4R1 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 4, regulatory subunit 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146081.2-1801s21c1
Sequence:CCGGCGACACTTGTGTGCCTTTGATCTCGAGATCAAAGGCACACAAGTGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146081.2-2726s21c1
Sequence:CCGGCCCAATGTTAGAGTGCTGCTTCTCGAGAAGCAGCACTCTAACATTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146081.2-252s21c1
Sequence:CCGGCTGCAAGTGAGAACGTATTTACTCGAGTAAATACGTTCTCACTTGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146081.2-3134s21c1
Sequence:CCGGAGTAAATCTCAGAGGATTATACTCGAGTATAATCCTCTGAGATTTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146081.1-1699s1c1
Sequence:CCGGCCCAATGTTAGAGTGCTGCTTCTCGAGAAGCAGCACTCTAACATTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146081.1-761s1c1
Sequence:CCGGGTAACATAAGTCACGACACTTCTCGAGAAGTGTCGTGACTTATGTTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146081.1-1317s1c1
Sequence:CCGGCAACAGTAGAAATTGGCGCTTCTCGAGAAGCGCCAATTTCTACTGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146081.1-774s1c1
Sequence:CCGGCGACACTTGTGTGCCTTTGATCTCGAGATCAAAGGCACACAAGTGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146081.1-1871s1c1
Sequence:CCGGCCAAACTCTCTGAAGATGCAACTCGAGTTGCATCTTCAGAGAGTTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146081.2-2344s21c1
Sequence:CCGGCAACAGTAGAAATTGGCGCTTCTCGAGAAGCGCCAATTTCTACTGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005134
VALIDATED
PPP4R1 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 4, regulatory subunit 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005134.2-1319s21c1
Sequence:CCGGGCAGCTAGTAATGAGAATGATCTCGAGATCATTCTCATTACTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005134.2-2390s21c1
Sequence:CCGGCCCAGAGATGTTTATGACTATCTCGAGATAGTCATAAACATCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005134.2-230s21c1
Sequence:CCGGGCTGCAAGTGAGAACATATTTCTCGAGAAATATGTTCTCACTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005134.1-907s1c1
Sequence:CCGGCGGACCAAATTATCAGCACTTCTCGAGAAGTGCTGATAATTTGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005134.1-1294s1c1
Sequence:CCGGGCAGCTAGTAATGAGAATGATCTCGAGATCATTCTCATTACTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005134.1-2365s1c1
Sequence:CCGGCCCAGAGATGTTTATGACTATCTCGAGATAGTCATAAACATCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005134.2-2924s21c1
Sequence:GTACCGGGCTTGAATCTCGGTGTCTTTCCTCGAGGAAAGACACCGAGATTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005134.2-1925s21c1
Sequence:CCGGGCGTTGTTAGATCAGTATTTACTCGAGTAAATACTGATCTAACAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005134
VALIDATED
PPP4R1 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 4, regulatory subunit 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005134.2-1319s21c1
Sequence:CCGGGCAGCTAGTAATGAGAATGATCTCGAGATCATTCTCATTACTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005134.2-2390s21c1
Sequence:CCGGCCCAGAGATGTTTATGACTATCTCGAGATAGTCATAAACATCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005134.2-230s21c1
Sequence:CCGGGCTGCAAGTGAGAACATATTTCTCGAGAAATATGTTCTCACTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005134.1-907s1c1
Sequence:CCGGCGGACCAAATTATCAGCACTTCTCGAGAAGTGCTGATAATTTGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005134.1-1294s1c1
Sequence:CCGGGCAGCTAGTAATGAGAATGATCTCGAGATCATTCTCATTACTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005134.1-2365s1c1
Sequence:CCGGCCCAGAGATGTTTATGACTATCTCGAGATAGTCATAAACATCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005134.2-2924s21c1
Sequence:GTACCGGGCTTGAATCTCGGTGTCTTTCCTCGAGGAAAGACACCGAGATTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005134.2-1925s21c1
Sequence:CCGGGCGTTGTTAGATCAGTATTTACTCGAGTAAATACTGATCTAACAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005134
VALIDATED
PPP4R1 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 4, regulatory subunit 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005134.2-1319s21c1
Sequence:CCGGGCAGCTAGTAATGAGAATGATCTCGAGATCATTCTCATTACTAGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000331399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005134.2-2390s21c1
Sequence:CCGGCCCAGAGATGTTTATGACTATCTCGAGATAGTCATAAACATCTCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000331462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005134.2-230s21c1
Sequence:CCGGGCTGCAAGTGAGAACATATTTCTCGAGAAATATGTTCTCACTTGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005134.1-907s1c1
Sequence:CCGGCGGACCAAATTATCAGCACTTCTCGAGAAGTGCTGATAATTTGGTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005134.1-1294s1c1
Sequence:CCGGGCAGCTAGTAATGAGAATGATCTCGAGATCATTCTCATTACTAGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005134.1-2365s1c1
Sequence:CCGGCCCAGAGATGTTTATGACTATCTCGAGATAGTCATAAACATCTCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005134.2-2924s21c1
Sequence:GTACCGGGCTTGAATCTCGGTGTCTTTCCTCGAGGAAAGACACCGAGATTCAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000301084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005134.2-1925s21c1
Sequence:CCGGGCGTTGTTAGATCAGTATTTACTCGAGTAAATACTGATCTAACAACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???