EMAIL THIS PAGE TO A FRIEND

PPP4R1L

protein phosphatase 4, regulatory subunit 1-like

40 Gene Product Result for
Synonyms: C20orf192 PRO1085
UniProtKB ID: Q9P1A2, B4DRM4, Q9BZ17, Q9BZ18
Gene ID:
chicken(419319) protein phosphatase 4, regulatory subunit 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502318 Anti-PPP4R1L antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4300942 Anti-PPP4R1L antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_086650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_086650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_086650 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018498 Rosetta Predictions human pricing
NR_003505 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080595 predicted 1379
2 SASI_Hs01_00080596 predicted 413
3 SASI_Hs01_00080597 predicted 1311
4 SASI_Hs01_00080598 predicted 323
5 SASI_Hs01_00080599 predicted 1148
6 SASI_Hs01_00080600 predicted 705
7 SASI_Hs01_00080601 predicted 1455
8 SASI_Hs01_00080602 predicted 541
9 SASI_Hs01_00080603 predicted 1147
10 SASI_Hs01_00080604 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379347 predicted 1968
2 SASI_Hs02_00379348 predicted 2062
3 SASI_Hs02_00379349 predicted 1374
4 SASI_Hs02_00379350 predicted 1796
5 SASI_Hs02_00379351 predicted 2145
6 SASI_Hs02_00379352 predicted 1304
7 SASI_Hs02_00379353 predicted 1136
8 SASI_Hs02_00379354 predicted 701
9 SASI_Hs02_00379355 predicted 2119
10 SASI_Hs02_00379356 predicted 1901
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_086650
PPP4R1L MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 4, regulatory subunit 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-964s1c1
Sequence:CCGGCCAGTTTAACTCGTTCAGCAACTCGAGTTGCTGAACGAGTTAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-384s1c1
Sequence:CCGGCCAGTGGTGCTCTCTGAATATCTCGAGATATTCAGAGAGCACCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-552s1c1
Sequence:CCGGCGGAAGGTTTGTGCTGCAAATCTCGAGATTTGCAGCACAAACCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-242s1c1
Sequence:CCGGCGGTAACAATGAAGAAGACTTCTCGAGAAGTCTTCTTCATTGTTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-47s1c1
Sequence:CCGGGCAGGATGACTTAGACGACTACTCGAGTAGTCGTCTAAGTCATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_086650
PPP4R1L MISSION shRNA shRNA Plasmid DNA
protein phosphatase 4, regulatory subunit 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-964s1c1
Sequence:CCGGCCAGTTTAACTCGTTCAGCAACTCGAGTTGCTGAACGAGTTAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-384s1c1
Sequence:CCGGCCAGTGGTGCTCTCTGAATATCTCGAGATATTCAGAGAGCACCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-552s1c1
Sequence:CCGGCGGAAGGTTTGTGCTGCAAATCTCGAGATTTGCAGCACAAACCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-242s1c1
Sequence:CCGGCGGTAACAATGAAGAAGACTTCTCGAGAAGTCTTCTTCATTGTTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-47s1c1
Sequence:CCGGGCAGGATGACTTAGACGACTACTCGAGTAGTCGTCTAAGTCATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_086650
PPP4R1L MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 4, regulatory subunit 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-964s1c1
Sequence:CCGGCCAGTTTAACTCGTTCAGCAACTCGAGTTGCTGAACGAGTTAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-384s1c1
Sequence:CCGGCCAGTGGTGCTCTCTGAATATCTCGAGATATTCAGAGAGCACCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-552s1c1
Sequence:CCGGCGGAAGGTTTGTGCTGCAAATCTCGAGATTTGCAGCACAAACCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-242s1c1
Sequence:CCGGCGGTAACAATGAAGAAGACTTCTCGAGAAGTCTTCTTCATTGTTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_086650.5-47s1c1
Sequence:CCGGGCAGGATGACTTAGACGACTACTCGAGTAGTCGTCTAAGTCATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)