EMAIL THIS PAGE TO A FRIEND

PPP4R2

protein phosphatase 4, regulatory subunit 2

86 Gene Product Result for
Synonyms: PP4R2
UniProtKB ID: Q9NY27, A8K1I6, Q2TAJ9, Q498B8, Q8WXX6
Gene ID:
Mouse(232314) protein phosphatase 4, regulatory subunit 2
Rat(297486) protein phosphatase 4, regulatory subunit 2
cow(504900) protein phosphatase 4, regulatory subunit 2
sheep(101113890) protein phosphatase 4, regulatory subunit 2
naked mole-rat(101726544) protein phosphatase 4, regulatory subunit 2
domestic guinea pig(100730377) protein phosphatase 4, regulatory subunit 2
chicken(416098) protein phosphatase 4, regulatory subunit 2
dog(476556) protein phosphatase 4, regulatory subunit 2
Horse(100061905) protein phosphatase 4, regulatory subunit 2
domestic cat(101096299) protein phosphatase 4, regulatory subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174907 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174907 Rosetta Predictions human pricing
NM_001106613 Rosetta Predictions rat pricing
NM_182939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141924 predicted 346
2 SASI_Hs01_00141925 predicted 597
3 SASI_Hs01_00141926 predicted 297
4 SASI_Hs01_00141930 predicted 340
5 SASI_Hs01_00141931 predicted 595
6 SASI_Hs02_00368811 predicted 462
7 SASI_Hs02_00368812 predicted 371
8 SASI_Hs02_00368813 predicted 406
9 SASI_Hs02_00368814 predicted 392
10 SASI_Hs02_00368815 predicted 367
11 SASI_Hs01_00141927 predicted 521
12 SASI_Hs01_00141928 predicted 463
13 SASI_Hs01_00141929 predicted 711
14 SASI_Hs01_00141932 predicted 498
15 SASI_Hs01_00141933 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220668 predicted 431
2 SASI_Rn02_00220669 predicted 637
3 SASI_Rn02_00220670 predicted 630
4 SASI_Rn02_00220671 predicted 745
5 SASI_Rn02_00220672 predicted 814
6 SASI_Rn02_00220673 predicted 495
7 SASI_Rn02_00220674 predicted 660
8 SASI_Rn02_00220675 predicted 517
9 SASI_Rn02_00220676 predicted 666
10 SASI_Rn02_00220677 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189424 predicted 458
2 SASI_Mm01_00189425 predicted 573
3 SASI_Mm01_00189426 predicted 519
4 SASI_Mm01_00189427 predicted 908
5 SASI_Mm01_00189429 predicted 774
6 SASI_Mm01_00189430 predicted 914
7 SASI_Mm01_00189431 predicted 535
8 SASI_Mm01_00189432 predicted 654
9 SASI_Mm02_00349987 predicted 1468
10 SASI_Mm01_00189433 predicted 516
11 SASI_Mm01_00189428 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174907
VALIDATED
PPP4R2 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 4, regulatory subunit 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_174907.1-1202s1c1
Sequence:CCGGCGTGAAACAGAAGAATTAGTACTCGAGTACTAATTCTTCTGTTTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174907.1-1061s1c1
Sequence:CCGGGATGCCTTAACTGTGAATGAACTCGAGTTCATTCACAGTTAAGGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_174907.1-1173s1c1
Sequence:CCGGGCCCTGTAAGTAGTAGTTCTTCTCGAGAAGAACTACTACTTACAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174907.1-182s1c1
Sequence:CCGGACAATGATTCAGTGGTCCCAACTCGAGTTGGGACCACTGAATCATTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174907.1-1345s1c1
Sequence:CCGGGCAGTATTTTACATACAGTTCCTCGAGGAACTGTATGTAAAATACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174907.2-1168s21c1
Sequence:CCGGCGAAGGCCCTGTAAGTAGTAGCTCGAGCTACTACTTACAGGGCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174907.2-526s21c1
Sequence:CCGGTGTTATGTTTCCTGGAAATTCCTCGAGGAATTTCCAGGAAACATAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174907.2-299s21c1
Sequence:CCGGTATATTCCCTTTGATGAAATGCTCGAGCATTTCATCAAAGGGAATATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174907.2-1310s21c1
Sequence:CCGGATGGAACAAGACTAACTATTTCTCGAGAAATAGTTAGTCTTGTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174907
VALIDATED
PPP4R2 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 4, regulatory subunit 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_174907.1-1202s1c1
Sequence:CCGGCGTGAAACAGAAGAATTAGTACTCGAGTACTAATTCTTCTGTTTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174907.1-1061s1c1
Sequence:CCGGGATGCCTTAACTGTGAATGAACTCGAGTTCATTCACAGTTAAGGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_174907.1-1173s1c1
Sequence:CCGGGCCCTGTAAGTAGTAGTTCTTCTCGAGAAGAACTACTACTTACAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174907.1-182s1c1
Sequence:CCGGACAATGATTCAGTGGTCCCAACTCGAGTTGGGACCACTGAATCATTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174907.1-1345s1c1
Sequence:CCGGGCAGTATTTTACATACAGTTCCTCGAGGAACTGTATGTAAAATACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174907.2-1168s21c1
Sequence:CCGGCGAAGGCCCTGTAAGTAGTAGCTCGAGCTACTACTTACAGGGCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174907.2-526s21c1
Sequence:CCGGTGTTATGTTTCCTGGAAATTCCTCGAGGAATTTCCAGGAAACATAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174907.2-299s21c1
Sequence:CCGGTATATTCCCTTTGATGAAATGCTCGAGCATTTCATCAAAGGGAATATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174907.2-1310s21c1
Sequence:CCGGATGGAACAAGACTAACTATTTCTCGAGAAATAGTTAGTCTTGTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174907
VALIDATED
PPP4R2 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 4, regulatory subunit 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_174907.1-1202s1c1
Sequence:CCGGCGTGAAACAGAAGAATTAGTACTCGAGTACTAATTCTTCTGTTTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174907.1-1061s1c1
Sequence:CCGGGATGCCTTAACTGTGAATGAACTCGAGTTCATTCACAGTTAAGGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_174907.1-1173s1c1
Sequence:CCGGGCCCTGTAAGTAGTAGTTCTTCTCGAGAAGAACTACTACTTACAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174907.1-182s1c1
Sequence:CCGGACAATGATTCAGTGGTCCCAACTCGAGTTGGGACCACTGAATCATTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174907.1-1345s1c1
Sequence:CCGGGCAGTATTTTACATACAGTTCCTCGAGGAACTGTATGTAAAATACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174907.2-1168s21c1
Sequence:CCGGCGAAGGCCCTGTAAGTAGTAGCTCGAGCTACTACTTACAGGGCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174907.2-526s21c1
Sequence:CCGGTGTTATGTTTCCTGGAAATTCCTCGAGGAATTTCCAGGAAACATAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174907.2-299s21c1
Sequence:CCGGTATATTCCCTTTGATGAAATGCTCGAGCATTTCATCAAAGGGAATATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174907.2-1310s21c1
Sequence:CCGGATGGAACAAGACTAACTATTTCTCGAGAAATAGTTAGTCTTGTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182939
VALIDATED
PPP4R2 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 4, regulatory subunit 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182939.1-2384s1c1
Sequence:CCGGCCCATAACATTCGGTTGCTTTCTCGAGAAAGCAACCGAATGTTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182939.1-744s1c1
Sequence:CCGGCTAATATAAACGGGCCTGGAACTCGAGTTCCAGGCCCGTTTATATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182939.1-1185s1c1
Sequence:CCGGCGTTTATGACACCAAGAGAAACTCGAGTTTCTCTTGGTGTCATAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182939.1-713s1c1
Sequence:CCGGCCTGGAAACTCACCAAACTATCTCGAGATAGTTTGGTGAGTTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182939.1-458s1c1
Sequence:CCGGCCCAATCCTAATGTTGAATATCTCGAGATATTCAACATTAGGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182939.4-457s21c1
Sequence:CCGGCCCAATCCTAATGTTGAATATCTCGAGATATTCAACATTAGGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182939.4-1184s21c1
Sequence:CCGGCGTTTATGACACCAAGAGAAACTCGAGTTTCTCTTGGTGTCATAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182939.4-729s21c1
Sequence:CCGGCTATACTGACAGGTCTAATATCTCGAGATATTAGACCTGTCAGTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182939.4-573s21c1
Sequence:CCGGGGATCCGAGAAGAAACTATACCTCGAGGTATAGTTTCTTCTCGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182939
VALIDATED
PPP4R2 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 4, regulatory subunit 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182939.1-2384s1c1
Sequence:CCGGCCCATAACATTCGGTTGCTTTCTCGAGAAAGCAACCGAATGTTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182939.1-744s1c1
Sequence:CCGGCTAATATAAACGGGCCTGGAACTCGAGTTCCAGGCCCGTTTATATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182939.1-1185s1c1
Sequence:CCGGCGTTTATGACACCAAGAGAAACTCGAGTTTCTCTTGGTGTCATAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182939.1-713s1c1
Sequence:CCGGCCTGGAAACTCACCAAACTATCTCGAGATAGTTTGGTGAGTTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182939.1-458s1c1
Sequence:CCGGCCCAATCCTAATGTTGAATATCTCGAGATATTCAACATTAGGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182939.4-457s21c1
Sequence:CCGGCCCAATCCTAATGTTGAATATCTCGAGATATTCAACATTAGGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182939.4-1184s21c1
Sequence:CCGGCGTTTATGACACCAAGAGAAACTCGAGTTTCTCTTGGTGTCATAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182939.4-729s21c1
Sequence:CCGGCTATACTGACAGGTCTAATATCTCGAGATATTAGACCTGTCAGTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182939.4-573s21c1
Sequence:CCGGGGATCCGAGAAGAAACTATACCTCGAGGTATAGTTTCTTCTCGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182939
VALIDATED
PPP4R2 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 4, regulatory subunit 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182939.1-2384s1c1
Sequence:CCGGCCCATAACATTCGGTTGCTTTCTCGAGAAAGCAACCGAATGTTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182939.1-744s1c1
Sequence:CCGGCTAATATAAACGGGCCTGGAACTCGAGTTCCAGGCCCGTTTATATTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182939.1-1185s1c1
Sequence:CCGGCGTTTATGACACCAAGAGAAACTCGAGTTTCTCTTGGTGTCATAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182939.1-713s1c1
Sequence:CCGGCCTGGAAACTCACCAAACTATCTCGAGATAGTTTGGTGAGTTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182939.1-458s1c1
Sequence:CCGGCCCAATCCTAATGTTGAATATCTCGAGATATTCAACATTAGGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182939.4-457s21c1
Sequence:CCGGCCCAATCCTAATGTTGAATATCTCGAGATATTCAACATTAGGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182939.4-1184s21c1
Sequence:CCGGCGTTTATGACACCAAGAGAAACTCGAGTTTCTCTTGGTGTCATAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182939.4-729s21c1
Sequence:CCGGCTATACTGACAGGTCTAATATCTCGAGATATTAGACCTGTCAGTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182939.4-573s21c1
Sequence:CCGGGGATCCGAGAAGAAACTATACCTCGAGGTATAGTTTCTTCTCGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)