EMAIL THIS PAGE TO A FRIEND

PPP4R4

protein phosphatase 4, regulatory subunit 4

122 Gene Product Result for
Synonyms: KIAA1622 PP4R4
UniProtKB ID: Q6NUP7, Q9BUF8, Q9HCF0
Gene ID:
Human(57718) Summary: The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The function of this particular gene product has not been determined. Alternative splicing has been observed for this gene and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(74521) protein phosphatase 4, regulatory subunit 4
Rat(500711) protein phosphatase 4, regulatory subunit 4
Zebrafish(567930) protein phosphatase 4, regulatory subunit 4
domestic cat(101088674) protein phosphatase 4, regulatory subunit 4
Horse(100064914) protein phosphatase 4, regulatory subunit 4
dog(490837) protein phosphatase 4, regulatory subunit 4
chicken(423430) protein phosphatase 4, regulatory subunit 4
domestic guinea pig(100734400) protein phosphatase 4, regulatory subunit 4
naked mole-rat(101708472) protein phosphatase 4, regulatory subunit 4
Domestic Rabbit(100357964) protein phosphatase 4, regulatory subunit 4
cow(537521) protein phosphatase 4, regulatory subunit 4
sheep(101115317) protein phosphatase 4, regulatory subunit 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020958 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028980 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028980 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028980 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020958 Rosetta Predictions human pricing
NM_058237 Rosetta Predictions human pricing
NM_001134632 Rosetta Predictions rat pricing
NM_028980 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177667 predicted 574
2 SASI_Hs01_00177668 predicted 421
3 SASI_Hs01_00177669 predicted 510
4 SASI_Hs01_00177670 predicted 650
5 SASI_Hs01_00177671 predicted 474
6 SASI_Hs02_00354384 predicted 446
7 SASI_Hs01_00177672 predicted 476
8 SASI_Hs01_00177673 predicted 586
9 SASI_Hs02_00354385 predicted 411
10 SASI_Hs01_00177675 predicted 400
11 SASI_Hs01_00177674 predicted 670
12 SASI_Hs01_00177676 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053598 predicted 835
2 SASI_Hs02_00362141 predicted 1385
3 SASI_Hs01_00053600 predicted 472
4 SASI_Hs01_00053601 predicted 1992
5 SASI_Hs02_00362142 predicted 2074
6 SASI_Hs01_00053602 predicted 975
7 SASI_Hs02_00362143 predicted 2600
8 SASI_Hs01_00053603 predicted 703
9 SASI_Hs01_00053604 predicted 1693
10 SASI_Hs01_00053605 predicted 2616
11 SASI_Hs01_00053597 predicted 551
12 SASI_Hs01_00053599 predicted 1139
13 SASI_Hs01_00053606 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134632 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257799 predicted 221
2 SASI_Rn02_00257800 predicted 1483
3 SASI_Rn02_00257801 predicted 807
4 SASI_Rn02_00257802 predicted 1552
5 SASI_Rn02_00257803 predicted 745
6 SASI_Rn02_00257804 predicted 2293
7 SASI_Rn02_00257805 predicted 2388
8 SASI_Rn02_00257806 predicted 1759
9 SASI_Rn02_00257807 predicted 419
10 SASI_Rn02_00257808 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028980 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057531 predicted 1396
2 SASI_Mm01_00057532 predicted 217
3 SASI_Mm01_00057533 predicted 1606
4 SASI_Mm01_00057534 predicted 807
5 SASI_Mm01_00057535 predicted 274
6 SASI_Mm01_00057536 predicted 420
7 SASI_Mm01_00057537 predicted 1114
8 SASI_Mm01_00057538 predicted 739
9 SASI_Mm01_00057539 predicted 307
10 SASI_Mm01_00057540 predicted 2694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020958
PPP4R4 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 4, regulatory subunit 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020958.2-415s21c1
Sequence:CCGGTGAGACGCTTCGGAGAGTGTTCTCGAGAACACTCTCCGAAGCGTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020958.2-464s1c1
Sequence:CCGGCACTTATTTATCCAGAGAGTACTCGAGTACTCTCTGGATAAATAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020958.2-302s1c1
Sequence:CCGGGATGAAGACCTCAGTGATATTCTCGAGAATATCACTGAGGTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020958.2-653s1c1
Sequence:CCGGCGGGAGTCAAGACTAAGTAATCTCGAGATTACTTAGTCTTGACTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020958.2-196s1c1
Sequence:CCGGGAACAGCCTGTTCGGTTACATCTCGAGATGTAACCGAACAGGCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020958.2-723s21c1
Sequence:CCGGTAAAGTTTGCATACGTACAAACTCGAGTTTGTACGTATGCAAACTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020958.2-591s21c1
Sequence:CCGGCCTGATAAGACTTGAGGATTTCTCGAGAAATCCTCAAGTCTTATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020958.2-365s21c1
Sequence:CCGGGGAACAAGTGTGATTGCAAATCTCGAGATTTGCAATCACACTTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020958
PPP4R4 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 4, regulatory subunit 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020958.2-415s21c1
Sequence:CCGGTGAGACGCTTCGGAGAGTGTTCTCGAGAACACTCTCCGAAGCGTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020958.2-464s1c1
Sequence:CCGGCACTTATTTATCCAGAGAGTACTCGAGTACTCTCTGGATAAATAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020958.2-302s1c1
Sequence:CCGGGATGAAGACCTCAGTGATATTCTCGAGAATATCACTGAGGTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020958.2-653s1c1
Sequence:CCGGCGGGAGTCAAGACTAAGTAATCTCGAGATTACTTAGTCTTGACTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020958.2-196s1c1
Sequence:CCGGGAACAGCCTGTTCGGTTACATCTCGAGATGTAACCGAACAGGCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020958.2-723s21c1
Sequence:CCGGTAAAGTTTGCATACGTACAAACTCGAGTTTGTACGTATGCAAACTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020958.2-591s21c1
Sequence:CCGGCCTGATAAGACTTGAGGATTTCTCGAGAAATCCTCAAGTCTTATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020958.2-365s21c1
Sequence:CCGGGGAACAAGTGTGATTGCAAATCTCGAGATTTGCAATCACACTTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020958
PPP4R4 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 4, regulatory subunit 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020958.2-415s21c1
Sequence:CCGGTGAGACGCTTCGGAGAGTGTTCTCGAGAACACTCTCCGAAGCGTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020958.2-464s1c1
Sequence:CCGGCACTTATTTATCCAGAGAGTACTCGAGTACTCTCTGGATAAATAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020958.2-302s1c1
Sequence:CCGGGATGAAGACCTCAGTGATATTCTCGAGAATATCACTGAGGTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020958.2-653s1c1
Sequence:CCGGCGGGAGTCAAGACTAAGTAATCTCGAGATTACTTAGTCTTGACTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020958.2-196s1c1
Sequence:CCGGGAACAGCCTGTTCGGTTACATCTCGAGATGTAACCGAACAGGCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020958.2-723s21c1
Sequence:CCGGTAAAGTTTGCATACGTACAAACTCGAGTTTGTACGTATGCAAACTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020958.2-591s21c1
Sequence:CCGGCCTGATAAGACTTGAGGATTTCTCGAGAAATCCTCAAGTCTTATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020958.2-365s21c1
Sequence:CCGGGGAACAAGTGTGATTGCAAATCTCGAGATTTGCAATCACACTTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028980
PPP4R4 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 4, regulatory subunit 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028980.1-1622s1c1
Sequence:CCGGCCAGATTTATTACCGTTTCTTCTCGAGAAGAAACGGTAATAAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028980.1-3389s1c1
Sequence:CCGGGCACCATTTGTACTAATGCTACTCGAGTAGCATTAGTACAAATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028980.2-2513s1c1
Sequence:CCGGGACTCATTCCGAACTCGAAATCTCGAGATTTCGAGTTCGGAATGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028980.2-2802s21c1
Sequence:CCGGGATGTGAAACTTGCCCTATTTCTCGAGAAATAGGGCAAGTTTCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028980.2-1610s21c1
Sequence:CCGGATATCGAGTGACCAGATTTATCTCGAGATAAATCTGGTCACTCGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028980.2-2423s21c1
Sequence:CCGGTTAGACCAGTGTGCTAGTAAACTCGAGTTTACTAGCACACTGGTCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028980.2-811s21c1
Sequence:CCGGTGTGGTGCTTCCCGAACTAATCTCGAGATTAGTTCGGGAAGCACCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028980.2-626s21c1
Sequence:CCGGTCGCGTTTAGTTAGCTGTAAACTCGAGTTTACAGCTAACTAAACGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028980.2-914s1c1
Sequence:CCGGGATGACAGAAGTCAAACTATACTCGAGTATAGTTTGACTTCTGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028980
PPP4R4 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 4, regulatory subunit 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028980.1-1622s1c1
Sequence:CCGGCCAGATTTATTACCGTTTCTTCTCGAGAAGAAACGGTAATAAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028980.1-3389s1c1
Sequence:CCGGGCACCATTTGTACTAATGCTACTCGAGTAGCATTAGTACAAATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028980.2-2513s1c1
Sequence:CCGGGACTCATTCCGAACTCGAAATCTCGAGATTTCGAGTTCGGAATGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028980.2-2802s21c1
Sequence:CCGGGATGTGAAACTTGCCCTATTTCTCGAGAAATAGGGCAAGTTTCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028980.2-1610s21c1
Sequence:CCGGATATCGAGTGACCAGATTTATCTCGAGATAAATCTGGTCACTCGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028980.2-2423s21c1
Sequence:CCGGTTAGACCAGTGTGCTAGTAAACTCGAGTTTACTAGCACACTGGTCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028980.2-811s21c1
Sequence:CCGGTGTGGTGCTTCCCGAACTAATCTCGAGATTAGTTCGGGAAGCACCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028980.2-626s21c1
Sequence:CCGGTCGCGTTTAGTTAGCTGTAAACTCGAGTTTACAGCTAACTAAACGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028980.2-914s1c1
Sequence:CCGGGATGACAGAAGTCAAACTATACTCGAGTATAGTTTGACTTCTGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028980
PPP4R4 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 4, regulatory subunit 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028980.1-1622s1c1
Sequence:CCGGCCAGATTTATTACCGTTTCTTCTCGAGAAGAAACGGTAATAAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028980.1-3389s1c1
Sequence:CCGGGCACCATTTGTACTAATGCTACTCGAGTAGCATTAGTACAAATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028980.2-2513s1c1
Sequence:CCGGGACTCATTCCGAACTCGAAATCTCGAGATTTCGAGTTCGGAATGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028980.2-2802s21c1
Sequence:CCGGGATGTGAAACTTGCCCTATTTCTCGAGAAATAGGGCAAGTTTCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028980.2-1610s21c1
Sequence:CCGGATATCGAGTGACCAGATTTATCTCGAGATAAATCTGGTCACTCGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028980.2-2423s21c1
Sequence:CCGGTTAGACCAGTGTGCTAGTAAACTCGAGTTTACTAGCACACTGGTCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028980.2-811s21c1
Sequence:CCGGTGTGGTGCTTCCCGAACTAATCTCGAGATTAGTTCGGGAAGCACCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028980.2-626s21c1
Sequence:CCGGTCGCGTTTAGTTAGCTGTAAACTCGAGTTTACAGCTAACTAAACGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028980.2-914s1c1
Sequence:CCGGGATGACAGAAGTCAAACTATACTCGAGTATAGTTTGACTTCTGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)